G853244



Basic Information


Item Value
gene id G853244
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 11005109 ~ 11005658 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU972516
atataactgtttggacataatgaccataattatgtttggaggaaaaagggggaggcttgcaagccgaagaacaccatcccaaccataaagcacgggggtgacagcatcatgttgtgggggtgctttgctgcaggagggactggtgcacttcacaaaataaatggcatcatgaggcaggaaaattatgtggatattttgaagcaacatctcaagacatcagtcaggaagttaaagcttggtcgcaaatgggtcttccaaatggacaataaccccgagcatacttccaaagttgtggcaaaatggcttaaggacaacaaagtcagggtattggagtggccatcacaaagctctgacctcaatcctatagaaaatgtgtgggcagaactgaaaaagcgtgtgcgagcaaggaggcctacaaccctgactcagttacaccagctctgtcaagaggaatggaccaaaattcacccaacttattgtgggaatcttgtggaaggctacctgaaacgtttgacccaagttaaacaatttaaaggcaatgctaccaaaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU972516 True 550 TUCP 0.45 1 11005109 11005658

Neighbor


gene id symbol gene type direction distance location
LOC110533336 LOC106603872 coding downstream 11316 10988789 ~ 10993793 (-)
LOC110533330 LOC106603879 coding downstream 155276 10760682 ~ 10849833 (-)
LOC118966706 NA coding downstream 296033 10707542 ~ 10709076 (-)
LOC118936914 NA coding downstream 455808 10547571 ~ 10549301 (-)
LOC110533324 LOC106603889 coding downstream 849867 10146911 ~ 10155242 (-)
bod1 LOC106603873 coding upstream 20429 11026087 ~ 11029511 (-)
LOC118936915 NA coding upstream 84363 11090021 ~ 11091274 (-)
LOC110533343 LOC106603867 coding upstream 461723 11467381 ~ 11474701 (-)
LOC110533344 LOC106603866 coding upstream 556278 11561936 ~ 11564213 (-)
LOC110533345 LOC106603865 coding upstream 561835 11567493 ~ 11583280 (-)
G853243 NA non-coding downstream 82 11004742 ~ 11005027 (-)
G853238 NA non-coding downstream 4125 11000616 ~ 11000984 (-)
G853237 NA non-coding downstream 7430 10997299 ~ 10997679 (-)
G853222 NA non-coding downstream 41528 10963276 ~ 10963581 (-)
G853202 NA non-coding downstream 100078 10904611 ~ 10905031 (-)
G853252 NA non-coding upstream 10526 11016184 ~ 11016474 (-)
G853265 NA non-coding upstream 26511 11032169 ~ 11032394 (-)
G853271 NA non-coding upstream 30674 11036332 ~ 11036622 (-)
G853276 NA non-coding upstream 35532 11041190 ~ 11041391 (-)
G852802 NA other downstream 542459 10462256 ~ 10462650 (-)
G850763 NA other downstream 2573068 8431531 ~ 8432041 (-)
G850323 NA other downstream 3258485 7741302 ~ 7746624 (-)
G849864 LOC106603950 other downstream 3561492 7400883 ~ 7443617 (-)
LOC110533297 LOC106603951 other downstream 3872544 7080591 ~ 7308250 (-)
G853740 NA other upstream 436594 11442252 ~ 11442590 (-)
G854016 LOC106603864 other upstream 609598 11615256 ~ 11620922 (-)
G854402 NA other upstream 779462 11785120 ~ 11785853 (-)
G854734 golga7b other upstream 1288445 12294103 ~ 12294536 (-)

Expression


G853244 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G853244 Expression in each Bioproject

Bar chart with 21 bars.
G853244 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network