G853828



Basic Information


Item Value
gene id G853828
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 11520450 ~ 11520649 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU973146
ccaggggcacagttcaacactcagacataatttacaaactaagcatttgtgtttagtgagtccaccaggtcagaggcagtagggatgaccagggatgttctcttgataagtgtgtgaattagacaatgtttatgtcctgctaagcattcaaaatgtaacgagtacttttgggtgtcatggaaaatgtaaggagtaaaaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU973146 True 200 lncRNA 0.41 1 11520450 11520649
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533343 LOC106603867 coding downstream 45749 11467381 ~ 11474701 (-)
LOC118936915 NA coding downstream 429176 11090021 ~ 11091274 (-)
bod1 LOC106603873 coding downstream 490939 11026087 ~ 11029511 (-)
LOC110533336 LOC106603872 coding downstream 526657 10988789 ~ 10993793 (-)
LOC110533330 LOC106603879 coding downstream 670617 10760682 ~ 10849833 (-)
LOC110533344 LOC106603866 coding upstream 41287 11561936 ~ 11564213 (-)
LOC110533345 LOC106603865 coding upstream 46844 11567493 ~ 11583280 (-)
kctd16b LOC106603861 coding upstream 266546 11787195 ~ 11868573 (-)
LOC110534849 LOC106567493 coding upstream 573685 12094334 ~ 12239835 (-)
trnaa-ugc-40 NA coding upstream 677576 12198225 ~ 12198294 (-)
G853824 NA non-coding downstream 1226 11518933 ~ 11519224 (-)
G853793 NA non-coding downstream 20849 11499237 ~ 11499601 (-)
G853718 NA non-coding downstream 91744 11428381 ~ 11428706 (-)
G853716 NA non-coding downstream 92746 11427325 ~ 11427704 (-)
G853710 NA non-coding downstream 102905 11417330 ~ 11417545 (-)
G853967 NA non-coding upstream 8217 11528866 ~ 11531054 (-)
G853968 NA non-coding upstream 10543 11531192 ~ 11532228 (-)
G853972 NA non-coding upstream 20548 11541197 ~ 11561248 (-)
G854017 NA non-coding upstream 97456 11618105 ~ 11619105 (-)
G854102 NA non-coding upstream 211418 11732067 ~ 11732317 (-)
G853740 NA other downstream 77860 11442252 ~ 11442590 (-)
G853244 NA other downstream 514792 11005109 ~ 11005658 (-)
G852802 NA other downstream 1057800 10462256 ~ 10462650 (-)
G850763 NA other downstream 3088409 8431531 ~ 8432041 (-)
G850323 NA other downstream 3773826 7741302 ~ 7746624 (-)
G854016 LOC106603864 other upstream 94607 11615256 ~ 11620922 (-)
G854402 NA other upstream 264471 11785120 ~ 11785853 (-)
G854734 golga7b other upstream 773454 12294103 ~ 12294536 (-)
G855079 sept8 other upstream 1060744 12581393 ~ 12611178 (-)

Expression


G853828 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G853828 Expression in each Bioproject

Bar chart with 18 bars.
G853828 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network