G854125



Basic Information


Item Value
gene id G854125
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 11744114 ~ 11749161 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU973479
attgtcatgtactgtcatgttgtcttgtctctgtcctttcccttcaccctgtctccctctgctggtcgtgttaggttaccttttctcccccgctttcccccagctgtcccttgtctcctctaactacccattcaccctgttccccacctgttcccttttttccctctgattaggtccctatatctctctctgtttctgctcctgtccttgtcggattcttgtttgtttgtgtcattcatgcctgaaccagactgtcgtcatgtttgctgtaaccttgtcctgtcctgtcggaatctgccggtccatctgagcctacctatgtttggtaattaaagaagctctgtttaagttgattcgcttttgggtcctcattcacgcaccgtaacaaga

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU973479 True 390 lncRNA 0.48 2 11744114 11749161
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533345 LOC106603865 coding downstream 160834 11567493 ~ 11583280 (-)
LOC110533344 LOC106603866 coding downstream 179901 11561936 ~ 11564213 (-)
LOC110533343 LOC106603867 coding downstream 269413 11467381 ~ 11474701 (-)
LOC118936915 NA coding downstream 652840 11090021 ~ 11091274 (-)
bod1 LOC106603873 coding downstream 714603 11026087 ~ 11029511 (-)
kctd16b LOC106603861 coding upstream 38034 11787195 ~ 11868573 (-)
LOC110534849 LOC106567493 coding upstream 345173 12094334 ~ 12239835 (-)
trnaa-ugc-40 NA coding upstream 449064 12198225 ~ 12198294 (-)
LOC118966708 NA coding upstream 518559 12267720 ~ 12270434 (-)
nfip1 nfip1 coding upstream 656673 12405834 ~ 12431079 (-)
G854116 NA non-coding downstream 4351 11739515 ~ 11739763 (-)
G854102 NA non-coding downstream 11797 11732067 ~ 11732317 (-)
G854017 NA non-coding downstream 125009 11618105 ~ 11619105 (-)
G853972 NA non-coding downstream 182866 11541197 ~ 11561248 (-)
G853968 NA non-coding downstream 211886 11531192 ~ 11532228 (-)
G854154 NA non-coding upstream 21189 11770350 ~ 11770565 (-)
G854155 NA non-coding upstream 21776 11770937 ~ 11771300 (-)
G854158 NA non-coding upstream 23638 11772799 ~ 11773029 (-)
G854401 NA non-coding upstream 32012 11781173 ~ 11783404 (-)
G854416 NA non-coding upstream 62852 11812013 ~ 11814524 (-)
G854016 LOC106603864 other downstream 123192 11615256 ~ 11620922 (-)
G853740 NA other downstream 301524 11442252 ~ 11442590 (-)
G853244 NA other downstream 738456 11005109 ~ 11005658 (-)
G852802 NA other downstream 1281464 10462256 ~ 10462650 (-)
G854402 NA other upstream 35959 11785120 ~ 11785853 (-)
G854734 golga7b other upstream 544942 12294103 ~ 12294536 (-)
G855079 sept8 other upstream 832232 12581393 ~ 12611178 (-)
G856922 NA other upstream 2435126 14184287 ~ 14184974 (-)
G856863 LOC106603829 other upstream 2454372 14203533 ~ 14210382 (-)

Expression


G854125 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G854125 Expression in each Bioproject

Bar chart with 17 bars.
G854125 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network