G854644



Basic Information


Item Value
gene id G854644
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 12201493 ~ 12202230 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU974032
CCTCTCACTATCACTACCCTCTCACTATCACTATCCTCTCACTATCACTACCCTCTCACTATCACTACCCTCTCACTACCCTCTCACTATCACTATCCTCTCACTATCACTACCCTCTCACTATCGCTACCCTCTCACTATCGCTACCTTCTCACTATCACTACCCTCTCACTATCACTACCCTCTCACTATCACGACCCTCTCACTATCGCTACCCTCTCACTATCACGACCCTCTCACTATCGCTACACTCTCACTATCGCTACCCTCTCACTATCGCTACCCTCTCACTATCAATACCCTCTCACTATCACTACCCTCTCACTATCACTACCCTCTCACTTTCAGTACCCTCTCACTATCACTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU974032 True 367 lncRNA 0.48 2 12201493 12202230
Loading

Neighbor


gene id symbol gene type direction distance location
trnaa-ugc-40 NA coding downstream 3199 12198225 ~ 12198294 (-)
kctd16b LOC106603861 coding downstream 332920 11787195 ~ 11868573 (-)
LOC110533345 LOC106603865 coding downstream 618213 11567493 ~ 11583280 (-)
LOC110533344 LOC106603866 coding downstream 637280 11561936 ~ 11564213 (-)
LOC110533343 LOC106603867 coding downstream 726792 11467381 ~ 11474701 (-)
LOC118966708 NA coding upstream 65490 12267720 ~ 12270434 (-)
nfip1 nfip1 coding upstream 203604 12405834 ~ 12431079 (-)
LOC118936498 LOC106567496 coding upstream 232462 12434692 ~ 12440598 (-)
LOC110533352 rnf14 coding upstream 245989 12448219 ~ 12470257 (-)
LOC110533353 LOC106603853 coding upstream 270720 12472950 ~ 12483345 (-)
G854623 NA non-coding downstream 33601 12167404 ~ 12167892 (-)
LOC110534849 LOC106567493 non-coding downstream 106159 12094334 ~ 12239835 (-)
G854512 NA non-coding downstream 223596 11977593 ~ 11977897 (-)
G854510 NA non-coding downstream 225569 11975605 ~ 11975924 (-)
G854508 NA non-coding downstream 229706 11971497 ~ 11971787 (-)
G854676 NA non-coding upstream 37681 12239911 ~ 12240132 (-)
G854677 NA non-coding upstream 38493 12240723 ~ 12240923 (-)
G854682 NA non-coding upstream 41181 12243411 ~ 12243616 (-)
G854691 NA non-coding upstream 51179 12253409 ~ 12253995 (-)
G854713 NA non-coding upstream 76172 12278402 ~ 12278646 (-)
G854402 NA other downstream 415640 11785120 ~ 11785853 (-)
G854016 LOC106603864 other downstream 580571 11615256 ~ 11620922 (-)
G853740 NA other downstream 758903 11442252 ~ 11442590 (-)
G853244 NA other downstream 1195835 11005109 ~ 11005658 (-)
G854734 golga7b other upstream 91873 12294103 ~ 12294536 (-)
G855079 sept8 other upstream 379163 12581393 ~ 12611178 (-)
G856922 NA other upstream 1982057 14184287 ~ 14184974 (-)
G856863 LOC106603829 other upstream 2001303 14203533 ~ 14210382 (-)
G856872 NA other upstream 2003042 14205272 ~ 14207216 (-)

Expression


G854644 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G854644 Expression in each Bioproject

Bar chart with 14 bars.
G854644 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network