G855624



Basic Information


Item Value
gene id G855624
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 13169579 ~ 13169882 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU975124
gctactatcttgtctcatcgctacaactcccgtatgggctcgggagagacgaaggttgaaagtcatgcgtcctccgatacacaacccaaccaagccgcactgcttcttaacacagcgtgcatccaatccggaagccagccgcaccaatgtgtcggaggaaacactgtgcacctggcccgccacaggagtcgctggtgcgcgatgagacaaggacatccctacaggccaagccctccctaacccggacgacgctaggccaattgtgtgtcgccccacggacctcccggtcgcggccggttatgac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU975124 True 304 lncRNA 0.60 1 13169579 13169882

Neighbor


gene id symbol gene type direction distance location
LOC110533358 sept8 coding upstream 541135 12581314 ~ 12628444 (+)
LOC110533356 LOC106603850 coding upstream 597828 12530904 ~ 12571751 (+)
LOC110533355 LOC106603851 coding upstream 644524 12498973 ~ 12525055 (+)
zcchc10 zcchc10 coding upstream 672301 12485809 ~ 12497278 (+)
LOC110533351 LOC106603857 coding upstream 849975 12312351 ~ 12319604 (+)
LOC110533363 LOC106603846 coding downstream 5381 13175263 ~ 13267400 (+)
sh3pxd2b LOC106603845 coding downstream 343549 13513431 ~ 13568699 (+)
LOC110534850 LOC106603841 coding downstream 467152 13637034 ~ 13736817 (+)
LOC110533370 pdli4 coding downstream 755920 13925802 ~ 13970129 (+)
LOC110533371 LOC106603835 coding downstream 872810 14042692 ~ 14053189 (+)
G855620 NA non-coding upstream 4707 13164673 ~ 13164872 (+)
G855587 NA non-coding upstream 25651 13086809 ~ 13143928 (+)
G855597 gabra1 non-coding upstream 45241 13114762 ~ 13124338 (+)
G855566 LOC106567505 non-coding upstream 67452 13097380 ~ 13102127 (+)
G855451 NA non-coding upstream 215626 12953747 ~ 12953953 (+)
G855986 NA non-coding downstream 244421 13414303 ~ 13474135 (+)
G855995 NA non-coding downstream 264811 13434693 ~ 13453525 (+)
G856002 NA non-coding downstream 318743 13488625 ~ 13489139 (+)
G856090 NA non-coding downstream 326329 13496211 ~ 13496420 (+)
G856092 NA non-coding downstream 328093 13497975 ~ 13498233 (+)
G855498 NA other upstream 148547 13016534 ~ 13021032 (+)
G855483 LOC106603848 other upstream 179737 12985031 ~ 12989842 (+)
G853577 NA other upstream 1853239 11315950 ~ 11316340 (+)
G853516 NA other upstream 1901943 11267374 ~ 11267636 (+)
G856353 NA other downstream 604005 13773887 ~ 13774582 (+)
tcf7 skp1 other downstream 1897086 15066890 ~ 15138685 (+)
G858148 NA other downstream 2244558 15414440 ~ 15434748 (+)
G858203 NA other downstream 2356507 15526389 ~ 15526807 (+)
G858416 NA other downstream 2704147 15874029 ~ 15878692 (+)

Expression


G855624 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G855624 Expression in each Bioproject

Bar chart with 19 bars.
G855624 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network