G855986



Basic Information


Item Value
gene id G855986
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 13414303 ~ 13474135 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU975524
gcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagttttaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttaattcttcacaaaaaaatacagttttatatctttatgtttgaagcctgaaatgtggcaaaaggtcgcaaagttcaagggggccgaatactttcgcaaggcactgtatacacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU975524 True 302 lncRNA 0.38 2 13414303 13474135

Neighbor


gene id symbol gene type direction distance location
LOC110533363 LOC106603846 coding upstream 146903 13175263 ~ 13267400 (+)
LOC110533358 sept8 coding upstream 785859 12581314 ~ 12628444 (+)
LOC110533356 LOC106603850 coding upstream 842552 12530904 ~ 12571751 (+)
LOC110533355 LOC106603851 coding upstream 889248 12498973 ~ 12525055 (+)
zcchc10 zcchc10 coding upstream 917025 12485809 ~ 12497278 (+)
sh3pxd2b LOC106603845 coding downstream 39296 13513431 ~ 13568699 (+)
LOC110534850 LOC106603841 coding downstream 162899 13637034 ~ 13736817 (+)
LOC110533370 pdli4 coding downstream 451667 13925802 ~ 13970129 (+)
LOC110533371 LOC106603835 coding downstream 568557 14042692 ~ 14053189 (+)
slc22a5 LOC106603832 coding downstream 594278 14068413 ~ 14077286 (+)
G855624 NA non-coding upstream 244421 13169579 ~ 13169882 (+)
G855620 NA non-coding upstream 249431 13164673 ~ 13164872 (+)
G855587 NA non-coding upstream 270375 13086809 ~ 13143928 (+)
G855597 gabra1 non-coding upstream 289965 13114762 ~ 13124338 (+)
G855566 LOC106567505 non-coding upstream 312176 13097380 ~ 13102127 (+)
G856002 NA non-coding downstream 14490 13488625 ~ 13489139 (+)
G856090 NA non-coding downstream 22076 13496211 ~ 13496420 (+)
G856092 NA non-coding downstream 23840 13497975 ~ 13498233 (+)
G856116 NA non-coding downstream 62643 13536778 ~ 13537002 (+)
G856119 NA non-coding downstream 68037 13542172 ~ 13542411 (+)
G855498 NA other upstream 393271 13016534 ~ 13021032 (+)
G855483 LOC106603848 other upstream 424461 12985031 ~ 12989842 (+)
G853577 NA other upstream 2097963 11315950 ~ 11316340 (+)
G853516 NA other upstream 2146667 11267374 ~ 11267636 (+)
G856353 NA other downstream 299752 13773887 ~ 13774582 (+)
tcf7 skp1 other downstream 1592833 15066890 ~ 15138685 (+)
G858148 NA other downstream 1940305 15414440 ~ 15434748 (+)
G858203 NA other downstream 2052254 15526389 ~ 15526807 (+)
G858416 NA other downstream 2399894 15874029 ~ 15878692 (+)

Expression


G855986 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G855986 Expression in each Bioproject

Bar chart with 16 bars.
G855986 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network