G858304



Basic Information


Item Value
gene id G858304
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 15728489 ~ 15729710 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU978085
ACAAGACATCAACAAGACACACAAGACATCAACAAGACACACAAGACATCAACAAGACACACATGACATCAACAAGACACACAAGACATCAACATGACACACAAGACATCAACAAGACCCACATGACACACAAGACATCAGCAAGACCCACATGACACACAAGACATCAGCAAGACACACAAGACATCAACAAGACACACAAGACATCAACAAGACACACAGGACATCAACAAGACACACATGACACACATGACATCAACAAGATACATATGACAGACAAGACATCAACATGACACGCATGACATCAACAAGACACACATGACACACATGACATCAACAAGACACACAAGACATCAACAAGACACACAAGACATCAACATGACACACAAGACATCAACATGACACACAAGACATCAACATGACACACAAGACATCAACATGACACACATGACACACAAGACATCAACA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU978085 True 468 lncRNA 0.41 2 15728489 15729710

Neighbor


gene id symbol gene type direction distance location
LOC110533414 LOC106603806 coding upstream 61938 15663485 ~ 15666551 (+)
sytl2a sytl2 coding upstream 66240 15615709 ~ 15662249 (+)
LOC110533412 NA coding upstream 121297 15543770 ~ 15607192 (+)
LOC110533411 LOC106603809 coding upstream 205150 15499633 ~ 15523339 (+)
LOC110534855 LOC106603811 coding upstream 246271 15208176 ~ 15482337 (+)
LOC110533419 LOC106603797 coding downstream 336688 16066398 ~ 16078694 (+)
smtlb LOC100196589 coding downstream 1444099 17173809 ~ 17176871 (+)
LOC110533429 nhlrc3 coding downstream 1615681 17345391 ~ 17359625 (+)
emsy LOC106603772 coding downstream 1632975 17362685 ~ 17395892 (+)
klhl35 klhl35 coding downstream 1713205 17442915 ~ 17454534 (+)
G858275 NA non-coding upstream 47575 15680679 ~ 15680914 (+)
G858274 NA non-coding upstream 54457 15673728 ~ 15674032 (+)
G858176 NA non-coding upstream 105628 15590095 ~ 15622861 (+)
G858225 NA non-coding upstream 145115 15582569 ~ 15583374 (+)
G858204 NA non-coding upstream 201405 15526868 ~ 15527084 (+)
G858330 NA non-coding downstream 33688 15763398 ~ 15763699 (+)
G858377 NA non-coding downstream 92108 15821818 ~ 15830938 (+)
G858452 NA non-coding downstream 198840 15928550 ~ 15930598 (+)
G859112 NA non-coding downstream 401101 16130811 ~ 16131049 (+)
G859114 NA non-coding downstream 402114 16131824 ~ 16132028 (+)
G858203 NA other upstream 201682 15526389 ~ 15526807 (+)
G858148 NA other upstream 293741 15414440 ~ 15434748 (+)
tcf7 skp1 other upstream 615990 15066890 ~ 15138685 (+)
G856353 NA other upstream 1953907 13773887 ~ 13774582 (+)
G855498 NA other upstream 2707457 13016534 ~ 13021032 (+)
G858416 NA other downstream 144319 15874029 ~ 15878692 (+)
G860453 NA other downstream 1372205 17101915 ~ 17102467 (+)
G860570 NA other downstream 1596530 17326240 ~ 17326929 (+)
G860846 NA other downstream 1765902 17495612 ~ 17499171 (+)
cenatac ccdc84 other downstream 3331604 19057354 ~ 19068272 (+)

Expression


G858304 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G858304 Expression in each Bioproject

Bar chart with 10 bars.
G858304 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network