G860416



Basic Information


Item Value
gene id G860416
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 17076523 ~ 17076726 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU980382
atcttgcctatgccgctctgtaccatcactcattcatatatctttatgtacatattctttatccccttacacttgtgtctataaggtagtagttttggaattgttagctagattacttgttggttattactgcattgtcggaactagaagcacaagcatttcgctacactcgcattaacatctgctaaccatgtgtatgtgacg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU980382 True 204 lncRNA 0.38 1 17076523 17076726
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118966710 LOC106583873 coding downstream 2717 17066129 ~ 17073806 (-)
kirrel3a kirrel3 coding downstream 147137 16657041 ~ 16929386 (-)
smfn rexo2 coding downstream 496010 16564265 ~ 16580513 (-)
LOC110533423 LOC106567546 coding downstream 590756 16363563 ~ 16485767 (-)
gramd1ba LOC106603792 coding downstream 754529 16186454 ~ 16332213 (-)
LOC110533426 ets1 coding upstream 133572 17210298 ~ 17233172 (-)
kcnj1b kcnj1 coding upstream 161189 17237915 ~ 17239115 (-)
LOC110533427 st3gal4 coding upstream 174977 17251703 ~ 17304636 (-)
dcps dcps coding upstream 237876 17314602 ~ 17324022 (-)
LOC110533431 LOC106603773 coding upstream 352524 17429250 ~ 17438483 (-)
G860406 NA non-coding downstream 16245 17057778 ~ 17060278 (-)
G860393 NA non-coding downstream 26575 17049349 ~ 17049948 (-)
G860331 NA non-coding downstream 72978 16951014 ~ 17003545 (-)
G860269 NA non-coding downstream 128008 16948055 ~ 16948515 (-)
G860215 NA non-coding downstream 174590 16900760 ~ 16901933 (-)
G860441 NA non-coding upstream 16637 17093363 ~ 17093602 (-)
G860636 NA non-coding upstream 70570 17147296 ~ 17150100 (-)
G860691 NA non-coding upstream 249788 17326514 ~ 17326908 (-)
G860740 NA non-coding upstream 284860 17361586 ~ 17361907 (-)
G860800 NA non-coding upstream 346944 17423670 ~ 17423922 (-)
G859594 NA other downstream 619676 16456548 ~ 16456847 (-)
LOC110533421 LOC106603793 other downstream 933786 16141284 ~ 16185730 (-)
LOC110534856 LOC106603798 other downstream 1038700 16018538 ~ 16057861 (-)
G858015 NA other downstream 1958494 15117422 ~ 15118029 (-)
LOC110533380 LOC106603823 other downstream 2503619 14557109 ~ 14794250 (-)
LOC110533434 LOC106603775 other upstream 445535 17520259 ~ 17545622 (-)
G862071 tmem132e other upstream 1324769 18401495 ~ 18405409 (-)
G862927 NA other upstream 1948616 19025342 ~ 19027578 (-)
G863863 NA other upstream 2782344 19859070 ~ 19860611 (-)
G865899 cssa04h11orf63 other upstream 4615037 21691763 ~ 21693197 (-)

Expression


G860416 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 125.
End of interactive chart.

G860416 Expression in each Bioproject

Bar chart with 18 bars.
G860416 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network