G863764



Basic Information


Item Value
gene id G863764
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 19674999 ~ 19675274 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU983930
gtacaacattaagacctattcagtctgtctacaaacaggctctcaaagtgcttgataggaagcccaatagccatcatcactgttacatcctcagaaagcatgagctcctgagttgggaaaatcttgtgcaatacaccgaagcatgtcttgtattcaagatcctaaatggcctggctccccctccactcagtatttttgttaaacaggaaacccaaacatatggcagcagatccacaaggtctgccatgagaggtgactgtatagttcccttaagga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU983930 True 276 lncRNA 0.44 1 19674999 19675274

Neighbor


gene id symbol gene type direction distance location
hepacamb LOC106603736 coding downstream 230080 19438410 ~ 19444919 (-)
ccdc15 ccdc15 coding downstream 241147 19424282 ~ 19433852 (-)
slc37a2 slc37a2 coding downstream 253518 19396507 ~ 19421481 (-)
LOC110533453 LOC106603739 coding downstream 278631 19379166 ~ 19396368 (-)
pou2f3 pou2f3 coding downstream 319422 19326064 ~ 19355577 (-)
LOC110533464 LOC106603726 coding upstream 56423 19731697 ~ 19742204 (-)
LOC110533470 LOC106603718 coding upstream 654733 20330007 ~ 20351563 (-)
LOC110533473 LOC106603710 coding upstream 881520 20556794 ~ 20589000 (-)
LOC110533474 LOC106603712 coding upstream 935345 20606575 ~ 20649954 (-)
LOC110533476 LOC106603709 coding upstream 958144 20633418 ~ 20648838 (-)
G863761 NA non-coding downstream 3591 19670684 ~ 19671408 (-)
G863760 NA non-coding downstream 4376 19668571 ~ 19670623 (-)
G863756 NA non-coding downstream 10131 19664628 ~ 19664868 (-)
G863710 NA non-coding downstream 21990 19592688 ~ 19653009 (-)
G863772 NA non-coding upstream 9860 19685134 ~ 19685359 (-)
G863780 NA non-coding upstream 35131 19710405 ~ 19710940 (-)
G863793 NA non-coding upstream 45137 19720411 ~ 19720629 (-)
G863799 NA non-coding upstream 50993 19726267 ~ 19726527 (-)
G862927 NA other downstream 647421 19025342 ~ 19027578 (-)
G862071 tmem132e other downstream 1269590 18401495 ~ 18405409 (-)
LOC110533434 LOC106603775 other downstream 2129523 17520259 ~ 17545622 (-)
G859594 NA other downstream 3218152 16456548 ~ 16456847 (-)
LOC110533421 LOC106603793 other downstream 3532262 16141284 ~ 16185730 (-)
G863863 NA other upstream 183796 19859070 ~ 19860611 (-)
G865899 cssa04h11orf63 other upstream 2016489 21691763 ~ 21693197 (-)
G865988 LOC106578276 other upstream 2083850 21759124 ~ 21759852 (-)
G866654 NA other upstream 2143837 21819111 ~ 21823621 (-)
LOC110533569 LOC106567674 other upstream 7214751 26890009 ~ 26911668 (-)

Expression


G863764 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G863764 Expression in each Bioproject

Bar chart with 18 bars.
G863764 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network