G868777



Basic Information


Item Value
gene id G868777
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 23733884 ~ 23734301 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU989352
ataatacacactgctcaaaaaaaataaagggaacacttaaacaacacaatgtaactccaagtcaatcacacttctgtgaaatcaaactgtccacttaggaagcaacactgattgacaatacatttaacatgctgttgtgcaaatggaatagacaacaggtggaaattataggcaattagcaagacacccccaataaaggagtggttctgcaggtggtgaccacagaccatttctcagttcctatgcttcctggctgatgttttggtcacttttgaatgctggcggtgctttcactctagtggtagcatgagacggagtctacaacccacacaagtggctcaggtagtgcagctaatccaggatgggacatcaatgcgagctgtggcaagaaggtttgctgtgtctgtcagcgtaatgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU989352 True 418 lncRNA 0.44 1 23733884 23734301
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533526 LOC106603674 coding downstream 340559 23348350 ~ 23393325 (-)
LOC110533524 vps26b coding downstream 418126 23308431 ~ 23315758 (-)
LOC110533523 LOC106603671 coding downstream 441004 23269923 ~ 23292880 (-)
LOC110533520 LOC106603666 coding downstream 618541 22873256 ~ 23115343 (-)
LOC110533517 LOC106603668 coding downstream 928511 22686425 ~ 22805373 (-)
LOC110534869 LOC106603642 coding upstream 431850 24166151 ~ 24669067 (-)
LOC110534871 LOC106567726 coding upstream 1887626 25621927 ~ 25634699 (-)
mybbp1a LOC106603631 coding upstream 2079330 25813631 ~ 25834759 (-)
rfc2 rfc2 coding upstream 2124034 25858335 ~ 25865920 (-)
LOC110533542 LOC106603436 coding upstream 2276420 26010721 ~ 26033162 (-)
G868668 NA non-coding downstream 152785 23580362 ~ 23581099 (-)
G868453 NA non-coding downstream 258239 23468277 ~ 23475645 (-)
G868442 NA non-coding downstream 286056 23440952 ~ 23447828 (-)
G868441 NA non-coding downstream 288139 23438942 ~ 23445745 (-)
G868339 NA non-coding downstream 427246 23306369 ~ 23306638 (-)
G868778 NA non-coding upstream 470 23734771 ~ 23735168 (-)
G868779 NA non-coding upstream 2001 23736302 ~ 23736598 (-)
G868782 NA non-coding upstream 7442 23741743 ~ 23742819 (-)
G868785 NA non-coding upstream 12402 23746703 ~ 23746932 (-)
G868787 NA non-coding upstream 13482 23747783 ~ 23748013 (-)
G866654 NA other downstream 1910263 21819111 ~ 21823621 (-)
G865988 LOC106578276 other downstream 1974032 21759124 ~ 21759852 (-)
G865899 cssa04h11orf63 other downstream 2040687 21691763 ~ 21693197 (-)
G863863 NA other downstream 3873273 19859070 ~ 19860611 (-)
G862927 NA other downstream 4706306 19025342 ~ 19027578 (-)
LOC110533569 LOC106567674 other upstream 3155724 26890009 ~ 26911668 (-)
G873209 orai2 other upstream 3428599 27162900 ~ 27164550 (-)
LOC110533580 tex14 other upstream 3618092 27330589 ~ 27366556 (-)
G873784 LOC106573797 other upstream 3848628 27582929 ~ 27584262 (-)
G874706 NA other upstream 4805928 28540229 ~ 28543267 (-)

Expression


G868777 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G868777 Expression in each Bioproject

Bar chart with 20 bars.
G868777 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network