G873297



Basic Information


Item Value
gene id G873297
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 27334844 ~ 27336456 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU994227
cggacattgcaatttattgccctggccacatctgcagacttcatgcctaaggcacgttcacgcagatgagcagggaccctaggcatctttcttttggtgtttttcagagtcagtagaaaggtgtctttagtgtcctaagttttcataactgtgaccttaattgcctaccgtctgtaagctgttagtgtcttaacgaccgttccacaggtgcatgttcattcattgtttatgggtcattgaacaagcatgg

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU994227 True 250 lncRNA 0.45 2 27334844 27336456
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533583 LOC100196673 coding downstream 23022 27305871 ~ 27311822 (-)
LOC110533581 gas2l2 coding downstream 29283 27289957 ~ 27305561 (-)
pex12 pex12 coding downstream 156157 27174930 ~ 27178687 (-)
LOC110533573 NA coding downstream 240142 27092272 ~ 27094702 (-)
LOC110533571 LOC106567671 coding downstream 253104 27058163 ~ 27081740 (-)
LOC110534878 trim37 coding upstream 163138 27499594 ~ 27539649 (-)
LOC110533586 rabgef1 coding upstream 207598 27544054 ~ 27563122 (-)
kctd7 LOC106603469 coding upstream 238171 27574627 ~ 27578300 (-)
LOC118936908 LOC106567662 coding upstream 253317 27589773 ~ 27592690 (-)
LOC110533589 LOC106603469 coding upstream 287596 27624052 ~ 27633778 (-)
G873273 NA non-coding downstream 33206 27301388 ~ 27301638 (-)
G873271 NA non-coding downstream 34903 27299604 ~ 27299941 (-)
G873191 NA non-coding downstream 161322 27173144 ~ 27173522 (-)
G873192 NA non-coding downstream 166054 27168038 ~ 27168790 (-)
G873209 orai2 non-coding downstream 170294 27162900 ~ 27164550 (-)
G873346 NA non-coding upstream 72314 27408770 ~ 27409200 (-)
G873409 NA non-coding upstream 161007 27497463 ~ 27499392 (-)
G873431 NA non-coding upstream 216162 27552618 ~ 27552840 (-)
G873432 NA non-coding upstream 217845 27554301 ~ 27555211 (-)
LOC110533569 LOC106567674 other downstream 423218 26890009 ~ 26911668 (-)
G866654 NA other downstream 5511223 21819111 ~ 21823621 (-)
G865988 LOC106578276 other downstream 5574992 21759124 ~ 21759852 (-)
G865899 cssa04h11orf63 other downstream 5641647 21691763 ~ 21693197 (-)
LOC110533580 tex14 other upstream 15937 27330589 ~ 27366556 (-)
G873784 LOC106573797 other upstream 246473 27582929 ~ 27584262 (-)
G874706 NA other upstream 1203773 28540229 ~ 28543267 (-)
G875194 NA other upstream 1604784 28941240 ~ 28985070 (-)
LOC110533621 NA other upstream 2578911 29906094 ~ 29922728 (-)

Expression


G873297 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G873297 Expression in each Bioproject

Bar chart with 18 bars.
G873297 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network