G874875



Basic Information


Item Value
gene id G874875
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 28828673 ~ 28828931 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU995928
cgtcccgcgccggagccgccaccatggacagacgcccacccggaccctccctattgttttgaggtgcgttcgggagtccgcaccttaggggggggggttctgtcacaccctggtcaaagtattttgtgtttatctttatttatttggtcaggccagggtgtggcatgggtttttgtaggtggtgtgtatgtatggggattgtagctagtggggtgttctagctaagtctatggctgtctgaagtggttctcaatcagag

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU995928 True 259 lncRNA 0.54 1 28828673 28828931

Neighbor


gene id symbol gene type direction distance location
LOC110533612 LOC106603488 coding downstream 13169 28731803 ~ 28815504 (-)
arl10 LOC106603486 coding downstream 180455 28643569 ~ 28648218 (-)
LOC110533606 LOC106603485 coding downstream 204324 28579433 ~ 28624349 (-)
LOC110533605 LOC106603484 coding downstream 268658 28549463 ~ 28560015 (-)
LOC110533602 NA coding downstream 435563 28388354 ~ 28399671 (-)
LOC110533613 LOC106603489 coding upstream 79460 28908391 ~ 29166800 (-)
cnot8 LOC106603492 coding upstream 697034 29525965 ~ 29530539 (-)
LOC110533616 LOC106603491 coding upstream 702999 29531930 ~ 29555369 (-)
LOC118966732 NA coding upstream 1009127 29838058 ~ 29838736 (-)
tbx16l LOC106603496 coding upstream 1053734 29882665 ~ 29899849 (-)
G874863 NA non-coding downstream 5784 28822651 ~ 28822889 (-)
G874775 NA non-coding downstream 180927 28647509 ~ 28647746 (-)
G874774 NA non-coding downstream 181359 28647084 ~ 28647314 (-)
G874749 NA non-coding downstream 183743 28644074 ~ 28644930 (-)
G874748 NA non-coding downstream 185177 28642298 ~ 28643496 (-)
G875167 NA non-coding upstream 64513 28893444 ~ 28893677 (-)
G875168 NA non-coding upstream 67360 28896291 ~ 28896686 (-)
G875132 NA non-coding upstream 73196 28902127 ~ 28935126 (-)
G875202 NA non-coding upstream 122940 28951871 ~ 28989388 (-)
G875352 NA non-coding upstream 344987 29173918 ~ 29174151 (-)
G874706 NA other downstream 285406 28540229 ~ 28543267 (-)
G873784 LOC106573797 other downstream 1244411 27582929 ~ 27584262 (-)
LOC110533580 tex14 other downstream 1475427 27330589 ~ 27366556 (-)
G873209 orai2 other downstream 1664123 27162900 ~ 27164550 (-)
LOC110533569 LOC106567674 other downstream 1917047 26890009 ~ 26911668 (-)
G875194 NA other upstream 112309 28941240 ~ 28985070 (-)
LOC110533621 NA other upstream 1086436 29906094 ~ 29922728 (-)
G878962 NA other upstream 2618551 31447482 ~ 31449163 (-)
G879440 LOC106603524 other upstream 3396501 32225432 ~ 32225936 (-)
LOC110533652 LOC106603525 other upstream 3418080 32246991 ~ 32353202 (-)

Expression


G874875 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G874875 Expression in each Bioproject

Bar chart with 20 bars.
G874875 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network