G874928



Basic Information


Item Value
gene id G874928
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 28891333 ~ 28891720 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU995982
tcatgaatttggatttgtgaactaaacgcgtgatgaaaaaggaggtatttggacataaaatatggactttatcgaacaaaacaaacatttattgttgaactgctattcctgggagtgcattctgatgaagatcatcaaagataagtgaatatttataatgctatttctgacttatgttgactacacaacatggcgggtatctgtatggcttgttttggtgtctgagcgctgtactcagattattgcatggtgtgctttttccgtaaagcttttttgaaatctgacacagcggttgcattaaggagaagtatatctttaattccatgtataacacttgtattttcatcaacatttatgatgagtatttctgtaaattgatgtggctctc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU995982 True 388 lncRNA 0.35 1 28891333 28891720
Loading

Neighbor


gene id symbol gene type direction distance location
rars1 syrc coding upstream 161966 28699373 ~ 28729367 (+)
LOC110533610 wwc1 coding upstream 197441 28648562 ~ 28693892 (+)
LOC110533607 LOC106603487 coding upstream 249619 28635794 ~ 28641714 (+)
LOC110533604 LOC106603483 coding upstream 348066 28419323 ~ 28543267 (+)
LOC110533603 LOC106603482 coding upstream 478411 28394195 ~ 28412922 (+)
LOC118936921 NA coding downstream 339831 29231527 ~ 29240203 (+)
gemin5 LOC106603490 coding downstream 614553 29506273 ~ 29525563 (+)
LOC118966731 NA coding downstream 694732 29586452 ~ 29629500 (+)
LOC110533617 LOC106603494 coding downstream 791555 29683275 ~ 29785295 (+)
LOC110533618 LOC106603495 coding downstream 912552 29804272 ~ 29836898 (+)
G874858 NA non-coding upstream 71781 28818673 ~ 28819552 (+)
G874508 NA non-coding upstream 165208 28725667 ~ 28726125 (+)
G874485 NA non-coding upstream 243228 28647658 ~ 28648105 (+)
G874472 NA non-coding upstream 246334 28643622 ~ 28644999 (+)
G874476 NA non-coding upstream 257891 28633148 ~ 28633442 (+)
G874931 NA non-coding downstream 1734 28893454 ~ 28893795 (+)
G874985 NA non-coding downstream 86639 28978359 ~ 28979023 (+)
G875115 NA non-coding downstream 276232 29167952 ~ 29168218 (+)
G875118 NA non-coding downstream 282199 29173919 ~ 29174119 (+)
G875119 NA non-coding downstream 284240 29175960 ~ 29176272 (+)
G874876 NA other upstream 61169 28829772 ~ 28830164 (+)
G874510 NA other upstream 152428 28727774 ~ 28738905 (+)
G874378 NA other upstream 306918 28577452 ~ 28584415 (+)
G874438 LOC106603484 other upstream 333689 28556540 ~ 28557644 (+)
LOC110533598 LOC106603479 other upstream 721080 28162794 ~ 28171287 (+)
G875756 LOC106603491 other downstream 654919 29546639 ~ 29547275 (+)
G875776 NA other downstream 689406 29581126 ~ 29582530 (+)
LOC110533619 LOC106603497 other downstream 1027556 29919276 ~ 29986082 (+)
G876079 ubb other downstream 1128921 30020641 ~ 30050053 (+)
LOC110533629 LOC106603502 other downstream 1129371 30021091 ~ 30022290 (+)

Expression


G874928 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G874928 Expression in each Bioproject

Bar chart with 20 bars.
G874928 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network