G875167



Basic Information


Item Value
gene id G875167
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 28893444 ~ 28893677 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU996227
aggaggtatcaggggtatgaagagtggaactaggggctccattgtaaactaagacaatgataactaacctgaacaacagtatacaaggcatattgacatttgagagagacatacagcgaggcatacagtagtcacaggtgttgaattgggagagctagctaaaacagtagctaaaacagtaggtgagacaacaacagctaatcagctagcacaacaacagcaggtaaaatggtg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU996227 True 234 lncRNA 0.42 1 28893444 28893677
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533612 LOC106603488 coding downstream 77940 28731803 ~ 28815504 (-)
arl10 LOC106603486 coding downstream 245226 28643569 ~ 28648218 (-)
LOC110533606 LOC106603485 coding downstream 269095 28579433 ~ 28624349 (-)
LOC110533605 LOC106603484 coding downstream 333429 28549463 ~ 28560015 (-)
LOC110533602 NA coding downstream 500334 28388354 ~ 28399671 (-)
LOC110533613 LOC106603489 coding upstream 14714 28908391 ~ 29166800 (-)
cnot8 LOC106603492 coding upstream 632288 29525965 ~ 29530539 (-)
LOC110533616 LOC106603491 coding upstream 638253 29531930 ~ 29555369 (-)
LOC118966732 NA coding upstream 944381 29838058 ~ 29838736 (-)
tbx16l LOC106603496 coding upstream 988988 29882665 ~ 29899849 (-)
G874875 NA non-coding downstream 64513 28828673 ~ 28828931 (-)
G874863 NA non-coding downstream 70555 28822651 ~ 28822889 (-)
G874775 NA non-coding downstream 245698 28647509 ~ 28647746 (-)
G874774 NA non-coding downstream 246130 28647084 ~ 28647314 (-)
G874749 NA non-coding downstream 248514 28644074 ~ 28644930 (-)
G875168 NA non-coding upstream 2614 28896291 ~ 28896686 (-)
G875132 NA non-coding upstream 8450 28902127 ~ 28935126 (-)
G875202 NA non-coding upstream 58194 28951871 ~ 28989388 (-)
G875352 NA non-coding upstream 280241 29173918 ~ 29174151 (-)
G875618 NA non-coding upstream 503698 29397375 ~ 29397579 (-)
G874706 NA other downstream 350177 28540229 ~ 28543267 (-)
G873784 LOC106573797 other downstream 1309182 27582929 ~ 27584262 (-)
LOC110533580 tex14 other downstream 1540198 27330589 ~ 27366556 (-)
G873209 orai2 other downstream 1728894 27162900 ~ 27164550 (-)
LOC110533569 LOC106567674 other downstream 1981818 26890009 ~ 26911668 (-)
G875194 NA other upstream 47563 28941240 ~ 28985070 (-)
LOC110533621 NA other upstream 1021690 29906094 ~ 29922728 (-)
G878962 NA other upstream 2553805 31447482 ~ 31449163 (-)
G879440 LOC106603524 other upstream 3331755 32225432 ~ 32225936 (-)
LOC110533652 LOC106603525 other upstream 3353334 32246991 ~ 32353202 (-)

Expression


G875167 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G875167 Expression in each Bioproject

Bar chart with 14 bars.
G875167 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network