G875168



Basic Information


Item Value
gene id G875168
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 28896291 ~ 28896686 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU996228
aaatgaggtgttggctttagggatgatcagtgggatacacctgctggagcgcgtgctacggatgggtgttgccatcgtgaccagtgaactgagataaggcggagctttacctagcatggacttgtagatgacctggagccagtgggtctggcgacaaatatgtagcgagggccagccgactagagcatacaagttgcagtggtgggtggtataaggtgctttagtgacaaaacggatggcactgtgataaactgcatccagtttgctgagtagagtgttggaagcaattttgtagatgacatcgccgaagtcgaggatcggtaggatagtcagttttactagggtaagtttggcggcgtgagtgaaggaggctttgttgcggaatagaaagacgat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU996228 True 396 lncRNA 0.50 1 28896291 28896686
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533612 LOC106603488 coding downstream 80787 28731803 ~ 28815504 (-)
arl10 LOC106603486 coding downstream 248073 28643569 ~ 28648218 (-)
LOC110533606 LOC106603485 coding downstream 271942 28579433 ~ 28624349 (-)
LOC110533605 LOC106603484 coding downstream 336276 28549463 ~ 28560015 (-)
LOC110533602 NA coding downstream 503181 28388354 ~ 28399671 (-)
LOC110533613 LOC106603489 coding upstream 11705 28908391 ~ 29166800 (-)
cnot8 LOC106603492 coding upstream 629279 29525965 ~ 29530539 (-)
LOC110533616 LOC106603491 coding upstream 635244 29531930 ~ 29555369 (-)
LOC118966732 NA coding upstream 941372 29838058 ~ 29838736 (-)
tbx16l LOC106603496 coding upstream 985979 29882665 ~ 29899849 (-)
G875167 NA non-coding downstream 2614 28893444 ~ 28893677 (-)
G874875 NA non-coding downstream 67360 28828673 ~ 28828931 (-)
G874863 NA non-coding downstream 73402 28822651 ~ 28822889 (-)
G874775 NA non-coding downstream 248545 28647509 ~ 28647746 (-)
G874774 NA non-coding downstream 248977 28647084 ~ 28647314 (-)
G875132 NA non-coding upstream 5441 28902127 ~ 28935126 (-)
G875202 NA non-coding upstream 55185 28951871 ~ 28989388 (-)
G875352 NA non-coding upstream 277232 29173918 ~ 29174151 (-)
G875618 NA non-coding upstream 500689 29397375 ~ 29397579 (-)
G875629 NA non-coding upstream 507058 29403744 ~ 29404148 (-)
G874706 NA other downstream 353024 28540229 ~ 28543267 (-)
G873784 LOC106573797 other downstream 1312029 27582929 ~ 27584262 (-)
LOC110533580 tex14 other downstream 1543045 27330589 ~ 27366556 (-)
G873209 orai2 other downstream 1731741 27162900 ~ 27164550 (-)
LOC110533569 LOC106567674 other downstream 1984665 26890009 ~ 26911668 (-)
G875194 NA other upstream 44554 28941240 ~ 28985070 (-)
LOC110533621 NA other upstream 1018681 29906094 ~ 29922728 (-)
G878962 NA other upstream 2550796 31447482 ~ 31449163 (-)
G879440 LOC106603524 other upstream 3328746 32225432 ~ 32225936 (-)
LOC110533652 LOC106603525 other upstream 3350325 32246991 ~ 32353202 (-)

Expression


G875168 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G875168 Expression in each Bioproject

Bar chart with 20 bars.
G875168 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network