G879269



Basic Information


Item Value
gene id G879269
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 31929936 ~ 31976562 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1000619
gaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcctggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1000619 True 205 lncRNA 0.46 2 31929936 31976562
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533647 LOC106603522 coding downstream 769426 31154471 ~ 31160510 (-)
LOC110534882 NA coding downstream 907711 31021462 ~ 31022225 (-)
LOC110533642 LOC106603612 coding downstream 971741 30954608 ~ 30958195 (-)
LOC110533638 aspa coding downstream 1188152 30737046 ~ 30741784 (-)
aspa aspa coding downstream 1193186 30724154 ~ 30736750 (-)
LOC110533652 LOC106603525 coding upstream 270429 32246991 ~ 32353202 (-)
LOC110533653 LOC106603526 coding upstream 377355 32353917 ~ 32356646 (-)
LOC110533654 LOC106603527 coding upstream 392124 32368686 ~ 32422880 (-)
LOC110533655 LOC106603528 coding upstream 456324 32432886 ~ 32447490 (-)
LOC110533657 LOC106567954 coding upstream 485997 32462559 ~ 32485561 (-)
G878917 NA non-coding downstream 573539 31352071 ~ 31356397 (-)
G878908 NA non-coding downstream 586720 31342372 ~ 31343216 (-)
G878841 NA non-coding downstream 658447 31257364 ~ 31271489 (-)
G877826 NA non-coding downstream 711442 31218287 ~ 31218494 (-)
G877808 NA non-coding downstream 725696 31204009 ~ 31204240 (-)
G879371 NA non-coding upstream 129678 32106240 ~ 32114281 (-)
G879453 NA non-coding upstream 266459 32243021 ~ 32243247 (-)
G879515 NA non-coding upstream 411907 32388469 ~ 32418267 (-)
G879557 NA non-coding upstream 472391 32448953 ~ 32452117 (-)
G879580 NA non-coding upstream 545677 32522239 ~ 32522461 (-)
G878962 NA other downstream 480773 31447482 ~ 31449163 (-)
LOC110533621 NA other downstream 2013431 29906094 ~ 29922728 (-)
G875194 NA other downstream 2944866 28941240 ~ 28985070 (-)
G874706 NA other downstream 3386669 28540229 ~ 28543267 (-)
G873784 LOC106573797 other downstream 4345674 27582929 ~ 27584262 (-)
G879440 LOC106603524 other upstream 248870 32225432 ~ 32225936 (-)
G879617 NA other upstream 609329 32585891 ~ 32588838 (-)
G879763 NA other upstream 813805 32790367 ~ 32790802 (-)
G880718 LOC106603546 other upstream 1059601 33036163 ~ 33037883 (-)

Expression


G879269 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G879269 Expression in each Bioproject

Bar chart with 17 bars.
G879269 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network