G884410



Basic Information


Item Value
gene id G884410
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 36723296 ~ 36723541 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1006375
atcaaatcaaatcaaatcaaatcaaatttgatttgtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataaccaacaagtaatctaactaacaattccaaaactactgtcttgtacacagtgtaaggggataaagaatatgtacataaggatatatgaatgagtgatggtacagagcagcataggcaagatacagtagatggt

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1006375 True 246 lncRNA 0.35 1 36723296 36723541

Neighbor


gene id symbol gene type direction distance location
LOC110533780 LOC106603359 coding downstream 11367 36704447 ~ 36711929 (-)
LOC110533101 LOC106603363 coding downstream 40393 36672252 ~ 36682903 (-)
scn4bb LOC106603364 coding downstream 57579 36652707 ~ 36665717 (-)
tmprss13b LOC106603367 coding downstream 87855 36618131 ~ 36635441 (-)
LOC118966763 NA coding downstream 118794 36598367 ~ 36604502 (-)
LOC110533103 tagl2 coding upstream 10175 36733716 ~ 36746690 (-)
LOC110533783 LOC106603358 coding upstream 57393 36780934 ~ 36785487 (-)
LOC110533786 LOC106603354 coding upstream 73188 36796729 ~ 36799658 (-)
LOC110533787 LOC106603353 coding upstream 78655 36802196 ~ 36806013 (-)
LOC110533789 LOC106603352 coding upstream 112878 36836419 ~ 36851211 (-)
G884409 NA non-coding downstream 391 36722551 ~ 36722905 (-)
G884402 NA non-coding downstream 20524 36702553 ~ 36702772 (-)
G884379 NA non-coding downstream 65063 36657830 ~ 36658233 (-)
G884367 NA non-coding downstream 82848 36640226 ~ 36640448 (-)
G884417 NA non-coding upstream 9177 36732718 ~ 36732949 (-)
G884423 NA non-coding upstream 17169 36740710 ~ 36742043 (-)
G884398 NA non-coding upstream 32461 36756002 ~ 36779726 (-)
G884519 NA non-coding upstream 198625 36922166 ~ 36922366 (-)
G884542 NA non-coding upstream 272951 36996492 ~ 37038509 (-)
G883754 NA other downstream 330769 36391103 ~ 36392527 (-)
G883753 NA other downstream 332382 36389997 ~ 36390914 (-)
G883128 NA other downstream 842345 35880524 ~ 35880951 (-)
G882971 rb1 other downstream 1124211 35598317 ~ 35599085 (-)
G884736 NA other upstream 593376 37316917 ~ 37318864 (-)
LOC110533823 LOC106603321 other upstream 875092 37518096 ~ 37704039 (-)
G885767 NA other upstream 1515409 38238950 ~ 38240559 (-)
rpl36a LOC106568029 other upstream 2460157 39183698 ~ 39185578 (-)
G887329 NA other upstream 2493772 39217313 ~ 39217738 (-)

Expression



Co-expression Network