G888700


Basic Information

Item Value
gene id G888700
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 40730890 ~ 40731782 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1011055
cataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaagctgaaaaattgggcgtgcaaaattattcagcccccttaagttaatactttgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgcctctatcagttttgcacattgagagactgaatttttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccagtctaacacctggatatgtttatttttgaaccattccattgtagatgttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttctcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgattctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgttgcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagc

Function

NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1011055 True 893 lncRNA 0.41 1 40730890 40731782
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110533881 LOC106603270 coding downstream 91229 40631165 ~ 40639661 (-)
LOC110533878 LOC106603271 coding downstream 183497 40496714 ~ 40547393 (-)
LOC110533872 LOC106603282 coding downstream 766079 39920761 ~ 39964811 (-)
LOC110533871 LOC106603284 coding downstream 811568 39904172 ~ 39919322 (-)
ksr1a LOC106603285 coding downstream 837162 39843126 ~ 39893728 (-)
LOC110533882 LOC106603268 coding upstream 108320 40840102 ~ 40853480 (-)
LOC110533890 LOC106603263 coding upstream 525042 41256824 ~ 41441750 (-)
LOC110533111 LOC106603235 coding upstream 743205 41474987 ~ 41475979 (-)
LOC110533892 LOC106603262 coding upstream 980529 41712311 ~ 41806880 (-)
LOC110533896 LOC106603257 coding upstream 1273044 42004826 ~ 42011726 (-)
G888687 NA non-coding downstream 7180 40723429 ~ 40723710 (-)
G888612 NA non-coding downstream 75692 40654967 ~ 40655198 (-)
G888505 NA non-coding downstream 268326 40462350 ~ 40462564 (-)
G888504 NA non-coding downstream 268874 40461676 ~ 40462016 (-)
G888485 NA non-coding downstream 293951 40436714 ~ 40436939 (-)
G888722 NA non-coding upstream 15582 40747364 ~ 40747573 (-)
G888752 NA non-coding upstream 44136 40775918 ~ 40776146 (-)
G888756 NA non-coding upstream 47741 40779523 ~ 40779925 (-)
G888757 NA non-coding upstream 50635 40782417 ~ 40782714 (-)
G889211 NA non-coding upstream 58762 40790544 ~ 40790847 (-)
G887329 NA other downstream 1513152 39217313 ~ 39217738 (-)
rpl36a LOC106568029 other downstream 1545396 39183698 ~ 39185578 (-)
G885767 NA other downstream 2490331 38238950 ~ 38240559 (-)
G890360 LOC106603260 other upstream 1250919 41982701 ~ 41984417 (-)
G890385 LOC100136012 other upstream 1255929 41987711 ~ 41989801 (-)
G890403 NA other upstream 1344959 42076741 ~ 42077947 (-)
LOC110533946 mpp1 other upstream 2327228 43057611 ~ 43070230 (-)
LOC110533954 LOC106603192 other upstream 2461900 43183815 ~ 43248006 (-)

Expression

G888700 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G888700 Expression in each Bioproject

Bar chart with 20 bars.
G888700 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network