G899078



Basic Information


Item Value
gene id G899078
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 50150919 ~ 50151140 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1022815
ggagatctttgtgggctatactcggccttgtctcaggatggtaagttggtggttgaagatatccctctagtggtgtgggggctgtgctttggcaaagtgggtggggttatatccttcctgtttggccctgtccgggggtgtcattggatggggccacagtgtctcctgacccctcctgtctcagccgccagtatttatgctgcagtagtttatgtgtcgggg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1022815 True 222 lncRNA 0.55 1 50150919 50151140

Neighbor


gene id symbol gene type direction distance location
LOC110533140 LOC106563775 coding downstream 101987 50045056 ~ 50048932 (-)
LOC110534205 LOC106603005 coding downstream 113240 50035811 ~ 50037679 (-)
LOC110534197 LOC106602918 coding downstream 355333 49772382 ~ 49795586 (-)
LOC110534195 NA coding downstream 416263 49733006 ~ 49734656 (-)
LOC110534929 NA coding downstream 489083 49649578 ~ 49661881 (-)
LOC110534213 LOC106602908 coding upstream 95714 50246298 ~ 50260435 (-)
grk1b NA coding upstream 167930 50319070 ~ 50326034 (-)
slc25a35 slc25a35 coding upstream 189976 50341116 ~ 50353286 (-)
LOC118936704 NA coding upstream 195382 50346522 ~ 50349995 (-)
tp53 tp53 coding upstream 236808 50387948 ~ 50399688 (-)
G898945 NA non-coding downstream 140933 50008145 ~ 50009986 (-)
G898863 NA non-coding downstream 161189 49988640 ~ 49989730 (-)
G898842 NA non-coding downstream 185081 49965639 ~ 49965838 (-)
G898798 NA non-coding downstream 253316 49897376 ~ 49897603 (-)
G898746 NA non-coding downstream 336176 49814535 ~ 49814743 (-)
G899079 NA non-coding upstream 545 50151685 ~ 50151966 (-)
G899411 NA non-coding upstream 7777 50158917 ~ 50159120 (-)
G899413 NA non-coding upstream 11047 50162187 ~ 50162507 (-)
G899417 NA non-coding upstream 15331 50166471 ~ 50166714 (-)
G899422 NA non-coding upstream 33304 50184444 ~ 50184725 (-)
LOC110534172 LOC106602940 other downstream 1266844 48881449 ~ 48907973 (-)
G896841 NA other downstream 2161843 47987761 ~ 47989076 (-)
LOC110534118 LOC106603020 other downstream 2917873 47203241 ~ 47234608 (-)
G894917 NA other downstream 4232580 45917279 ~ 45918339 (-)
LOC110534046 LOC107567170 other downstream 4400588 45747090 ~ 45751405 (-)
G899409 NA other upstream 5052 50156192 ~ 50156902 (-)
G899421 NA other upstream 31256 50182396 ~ 50182788 (-)
LOC110534220 LOC106602898 other upstream 314327 50463950 ~ 50482534 (-)
G899727 NA other upstream 569846 50720986 ~ 50721603 (-)
G899739 LOC106602890 other upstream 592018 50743158 ~ 50750233 (-)

Expression


G899078 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G899078 Expression in each Bioproject

Bar chart with 17 bars.
G899078 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network