G899421



Basic Information


Item Value
gene id G899421
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 50182396 ~ 50182788 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1023178
atgtgtttgtggtcacaccatgtctcgttaatcataaggcatatgcccccgcccctcttcttaccagaaagatgtttgtttctgtcggcgcgatgcatgaagaaaccagctggctgcaccgattccgttagcgtctctcgagtcagccatgtttccgtgaagcaaagaaagttacagtctctgatgtccctctggaatgctacccttgctcggatttcatcaaccttgttgtcaagagactggacattggtgagtagtatgctagggagtggtgcgcgatgtgcccgtctccggagcctgaccagaagaccgctacgtttccctcttttacgaagtctttgttttgggtcgcaggctgggatccattccgttgtcctgggtggagggcagaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1023178 True 393 TUCP 0.52 1 50182396 50182788
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533140 LOC106563775 coding downstream 133464 50045056 ~ 50048932 (-)
LOC110534205 LOC106603005 coding downstream 144717 50035811 ~ 50037679 (-)
LOC110534197 LOC106602918 coding downstream 386810 49772382 ~ 49795586 (-)
LOC110534195 NA coding downstream 447740 49733006 ~ 49734656 (-)
LOC110534929 NA coding downstream 520560 49649578 ~ 49661881 (-)
LOC110534213 LOC106602908 coding upstream 64066 50246298 ~ 50260435 (-)
grk1b NA coding upstream 136282 50319070 ~ 50326034 (-)
slc25a35 slc25a35 coding upstream 158328 50341116 ~ 50353286 (-)
LOC118936704 NA coding upstream 163734 50346522 ~ 50349995 (-)
tp53 tp53 coding upstream 205160 50387948 ~ 50399688 (-)
G899417 NA non-coding downstream 15682 50166471 ~ 50166714 (-)
G899413 NA non-coding downstream 19889 50162187 ~ 50162507 (-)
G899411 NA non-coding downstream 23276 50158917 ~ 50159120 (-)
G899079 NA non-coding downstream 30430 50151685 ~ 50151966 (-)
G899078 NA non-coding downstream 31256 50150919 ~ 50151140 (-)
G899422 NA non-coding upstream 1656 50184444 ~ 50184725 (-)
G899423 NA non-coding upstream 2022 50184810 ~ 50185015 (-)
G899434 NA non-coding upstream 14910 50197698 ~ 50197922 (-)
G899518 NA non-coding upstream 140048 50322836 ~ 50323087 (-)
G899409 NA other downstream 25494 50156192 ~ 50156902 (-)
LOC110534172 LOC106602940 other downstream 1298321 48881449 ~ 48907973 (-)
G896841 NA other downstream 2193320 47987761 ~ 47989076 (-)
LOC110534118 LOC106603020 other downstream 2949350 47203241 ~ 47234608 (-)
G894917 NA other downstream 4264057 45917279 ~ 45918339 (-)
LOC110534220 LOC106602898 other upstream 282679 50463950 ~ 50482534 (-)
G899727 NA other upstream 538198 50720986 ~ 50721603 (-)
G899739 LOC106602890 other upstream 560370 50743158 ~ 50750233 (-)
G900070 NA other upstream 787975 50970763 ~ 50981750 (-)
G900807 NA other upstream 1272712 51455500 ~ 51455942 (-)

Expression


G899421 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G899421 Expression in each Bioproject

Bar chart with 19 bars.
G899421 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network