G899423



Basic Information


Item Value
gene id G899423
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 50184810 ~ 50185015 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1023180
cggggtgaacaggcagtggctcgggtggttgttgtccttgatgatctttatggccttcctgtgacatcgggtggtgtaggtgtcctggagggcaggtagtttgcccccggtgatgcgttgtgcagacctcactaccctctgcagagccttacggttgtgggcggagcagttgccgtaccaggcggtgatacagcccgacaggatgc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1023180 True 206 lncRNA 0.60 1 50184810 50185015
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533140 LOC106563775 coding downstream 135878 50045056 ~ 50048932 (-)
LOC110534205 LOC106603005 coding downstream 147131 50035811 ~ 50037679 (-)
LOC110534197 LOC106602918 coding downstream 389224 49772382 ~ 49795586 (-)
LOC110534195 NA coding downstream 450154 49733006 ~ 49734656 (-)
LOC110534929 NA coding downstream 522974 49649578 ~ 49661881 (-)
LOC110534213 LOC106602908 coding upstream 61839 50246298 ~ 50260435 (-)
grk1b NA coding upstream 134055 50319070 ~ 50326034 (-)
slc25a35 slc25a35 coding upstream 156101 50341116 ~ 50353286 (-)
LOC118936704 NA coding upstream 161507 50346522 ~ 50349995 (-)
tp53 tp53 coding upstream 202933 50387948 ~ 50399688 (-)
G899422 NA non-coding downstream 85 50184444 ~ 50184725 (-)
G899417 NA non-coding downstream 18096 50166471 ~ 50166714 (-)
G899413 NA non-coding downstream 22303 50162187 ~ 50162507 (-)
G899411 NA non-coding downstream 25690 50158917 ~ 50159120 (-)
G899079 NA non-coding downstream 32844 50151685 ~ 50151966 (-)
G899434 NA non-coding upstream 12683 50197698 ~ 50197922 (-)
G899518 NA non-coding upstream 137821 50322836 ~ 50323087 (-)
G899524 NA non-coding upstream 146386 50331401 ~ 50351308 (-)
G899527 NA non-coding upstream 171325 50356340 ~ 50356801 (-)
G899421 NA other downstream 2022 50182396 ~ 50182788 (-)
G899409 NA other downstream 27908 50156192 ~ 50156902 (-)
LOC110534172 LOC106602940 other downstream 1300735 48881449 ~ 48907973 (-)
G896841 NA other downstream 2195734 47987761 ~ 47989076 (-)
LOC110534118 LOC106603020 other downstream 2951764 47203241 ~ 47234608 (-)
LOC110534220 LOC106602898 other upstream 280452 50463950 ~ 50482534 (-)
G899727 NA other upstream 535971 50720986 ~ 50721603 (-)
G899739 LOC106602890 other upstream 558143 50743158 ~ 50750233 (-)
G900070 NA other upstream 785748 50970763 ~ 50981750 (-)
G900807 NA other upstream 1270485 51455500 ~ 51455942 (-)

Expression


G899423 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G899423 Expression in each Bioproject

Bar chart with 16 bars.
G899423 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network