G899524



Basic Information


Item Value
gene id G899524
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 50331401 ~ 50351308 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1023289
cccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccaggatgctgccaccaccatgtttgacagtggggatggtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1023289 True 214 lncRNA 0.48 2 50331401 50351308
Loading

Neighbor


gene id symbol gene type direction distance location
grk1b NA coding downstream 5367 50319070 ~ 50326034 (-)
LOC110534213 LOC106602908 coding downstream 70966 50246298 ~ 50260435 (-)
LOC110533140 LOC106563775 coding downstream 282469 50045056 ~ 50048932 (-)
LOC110534205 LOC106603005 coding downstream 293722 50035811 ~ 50037679 (-)
LOC110534197 LOC106602918 coding downstream 535815 49772382 ~ 49795586 (-)
tp53 tp53 coding upstream 36640 50387948 ~ 50399688 (-)
LOC110534217 LOC106602903 coding upstream 49478 50400786 ~ 50442079 (-)
LOC110534218 LOC106602900 coding upstream 101145 50452453 ~ 50454285 (-)
LOC110534220 LOC106602898 coding upstream 112642 50463950 ~ 50482534 (-)
slc25a15b slc25a15 coding upstream 274822 50626130 ~ 50637048 (-)
G899518 NA non-coding downstream 8314 50322836 ~ 50323087 (-)
G899434 NA non-coding downstream 133479 50197698 ~ 50197922 (-)
G899423 NA non-coding downstream 146386 50184810 ~ 50185015 (-)
G899422 NA non-coding downstream 146676 50184444 ~ 50184725 (-)
G899527 NA non-coding upstream 5032 50356340 ~ 50356801 (-)
G899533 NA non-coding upstream 13255 50364563 ~ 50364817 (-)
G899616 NA non-coding upstream 154332 50505640 ~ 50505849 (-)
G899620 NA non-coding upstream 157790 50509098 ~ 50509346 (-)
G899421 NA other downstream 148613 50182396 ~ 50182788 (-)
G899409 NA other downstream 174499 50156192 ~ 50156902 (-)
LOC110534172 LOC106602940 other downstream 1447326 48881449 ~ 48907973 (-)
G896841 NA other downstream 2342325 47987761 ~ 47989076 (-)
LOC110534118 LOC106603020 other downstream 3098355 47203241 ~ 47234608 (-)
G899727 NA other upstream 369678 50720986 ~ 50721603 (-)
G899739 LOC106602890 other upstream 391850 50743158 ~ 50750233 (-)
G900070 NA other upstream 619455 50970763 ~ 50981750 (-)
G900807 NA other upstream 1104192 51455500 ~ 51455942 (-)

Expression


G899524 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G899524 Expression in each Bioproject

Bar chart with 18 bars.
G899524 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network