G899533



Basic Information


Item Value
gene id G899533
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 50364563 ~ 50364817 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1023298
atgctgtctgtgtcagtggaccaattcagtttgtctgtgatgtgtatgccgaggaacttaaaacttgctaccctctccactactgttccatcgatgtggataggtgggtgttccctctgctgtttcctgaagtccacaatcatctccttagttttgttgacgttgagtgtgaggttattttcctgacaccacactccgagggccctcacctcctccctgtaggccgtctcgtcgttgttggtaatcaagcctacc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1023298 True 255 lncRNA 0.49 1 50364563 50364817
Loading

Neighbor


gene id symbol gene type direction distance location
slc25a35 slc25a35 coding downstream 11277 50341116 ~ 50353286 (-)
LOC118936704 NA coding downstream 14568 50346522 ~ 50349995 (-)
grk1b NA coding downstream 38529 50319070 ~ 50326034 (-)
LOC110534213 LOC106602908 coding downstream 104128 50246298 ~ 50260435 (-)
LOC110533140 LOC106563775 coding downstream 315631 50045056 ~ 50048932 (-)
tp53 tp53 coding upstream 23131 50387948 ~ 50399688 (-)
LOC110534217 LOC106602903 coding upstream 35969 50400786 ~ 50442079 (-)
LOC110534218 LOC106602900 coding upstream 87636 50452453 ~ 50454285 (-)
LOC110534220 LOC106602898 coding upstream 99133 50463950 ~ 50482534 (-)
slc25a15b slc25a15 coding upstream 261313 50626130 ~ 50637048 (-)
G899527 NA non-coding downstream 7762 50356340 ~ 50356801 (-)
G899524 NA non-coding downstream 13255 50331401 ~ 50351308 (-)
G899518 NA non-coding downstream 41476 50322836 ~ 50323087 (-)
G899434 NA non-coding downstream 166641 50197698 ~ 50197922 (-)
G899616 NA non-coding upstream 140823 50505640 ~ 50505849 (-)
G899620 NA non-coding upstream 144281 50509098 ~ 50509346 (-)
G899626 NA non-coding upstream 156750 50521567 ~ 50611065 (-)
G899636 NA non-coding upstream 188897 50553714 ~ 50618858 (-)
G899421 NA other downstream 181775 50182396 ~ 50182788 (-)
G899409 NA other downstream 207661 50156192 ~ 50156902 (-)
LOC110534172 LOC106602940 other downstream 1480488 48881449 ~ 48907973 (-)
G896841 NA other downstream 2375487 47987761 ~ 47989076 (-)
LOC110534118 LOC106603020 other downstream 3131517 47203241 ~ 47234608 (-)
G899727 NA other upstream 356169 50720986 ~ 50721603 (-)
G899739 LOC106602890 other upstream 378341 50743158 ~ 50750233 (-)
G900070 NA other upstream 605946 50970763 ~ 50981750 (-)
G900807 NA other upstream 1090683 51455500 ~ 51455942 (-)

Expression


G899533 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G899533 Expression in each Bioproject

Bar chart with 13 bars.
G899533 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network