G900069 (LOC106602888)



Basic Information


Item Value
gene id G900069
gene name LOC106602888
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 50973847 ~ 50983259 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1023887
CTTTTCCACAGTGGAAGTTTTTGACACTGTCTCTTTCTGCTTGATGGTGCAGTGGAAGTTTTTGACACTGTCTCTTTCTGCTTGATGGTGCAGGTGAAGTTTTTGGGCTTGTCGTCGGAAAGGCCAGTGAGGTTGAGACGGCAGGTGGAGATGCCTTCCATGATGGCGACAGCACCACGGTTCTTGAAGGTGGGGTCCTGAATCTTAGCAGGGTCTGTGCTGCCCACCACATTGTTCTCCTGGGTGTATGTGCAGGTAGGAACTGGTGTCACAGCTGTCAGCTCATATTCACAGTCCATCCTCAGGTTTTTCTCCTTCGTCAGGCAGGAGGTCAGCTTAGTCACCTTCTGGGCTGAGGCAAAAC

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1023887 True 364 lncRNA 0.51 2 50973847 50983259

Neighbor


gene id symbol gene type direction distance location
si:ch211-215c18.3 NA coding downstream 11661 50953168 ~ 50962186 (-)
LOC110534228 NA coding downstream 206027 50721690 ~ 50767820 (-)
slc25a15b slc25a15 coding downstream 336799 50626130 ~ 50637048 (-)
LOC110534220 LOC106602898 coding downstream 491313 50463950 ~ 50482534 (-)
LOC110534218 LOC106602900 coding downstream 519562 50452453 ~ 50454285 (-)
LOC110534238 bco2b coding upstream 473837 51457096 ~ 51559902 (-)
LOC110534240 bco2b coding upstream 615368 51598627 ~ 51656987 (-)
adamts15a LOC106602881 coding upstream 1106572 52089831 ~ 52124329 (-)
atf5a LOC106602866 coding upstream 1293072 52276331 ~ 52281912 (-)
phldb1a LOC106602858 coding upstream 1328941 52312200 ~ 52396922 (-)
G899992 NA non-coding downstream 15597 50926201 ~ 50958250 (-)
G899939 NA non-coding downstream 141982 50790721 ~ 50831865 (-)
G899775 NA non-coding downstream 188028 50785606 ~ 50785819 (-)
G899755 NA non-coding downstream 202396 50771238 ~ 50771451 (-)
G899749 NA non-coding downstream 211474 50762160 ~ 50762373 (-)
G900078 NA non-coding upstream 11923 50995182 ~ 50995414 (-)
G900087 NA non-coding upstream 22051 51005310 ~ 51005722 (-)
G900094 NA non-coding upstream 54292 51037551 ~ 51038387 (-)
G900109 NA non-coding upstream 60848 51044107 ~ 51044599 (-)
G900596 LOC106602883 non-coding upstream 159294 51142553 ~ 51153981 (-)
G899739 LOC106602890 other downstream 223614 50743158 ~ 50750233 (-)
G899727 NA other downstream 252244 50720986 ~ 50721603 (-)
G899421 NA other downstream 791059 50182396 ~ 50182788 (-)
G899409 NA other downstream 816945 50156192 ~ 50156902 (-)
G900807 NA other upstream 472241 51455500 ~ 51455942 (-)
G902519 NA other upstream 1918935 52902194 ~ 52937648 (-)
casp3a LOC106602722 other upstream 2888980 53872239 ~ 53878829 (-)
G903619 primpol other upstream 2896285 53879544 ~ 53883773 (-)
cfap97 cfap97 other upstream 3098907 54082166 ~ 54111277 (-)

Expression


G900069(LOC106602888) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G900069(LOC106602888) Expression in each Bioproject

Bar chart with 12 bars.
G900069(LOC106602888) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network