G900807



Basic Information


Item Value
gene id G900807
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 51455500 ~ 51455942 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1024669
aaatcaaaaactgaaaaattgggcgtgcaaaattaaaagcgcagagagcatcatgaagaacaaagaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagacggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggagggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaaattcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctga

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1024669 True 443 TUCP 0.43 1 51455500 51455942
Loading

Neighbor


gene id symbol gene type direction distance location
si:ch211-215c18.3 NA coding downstream 493314 50953168 ~ 50962186 (-)
LOC110534228 NA coding downstream 687680 50721690 ~ 50767820 (-)
slc25a15b slc25a15 coding downstream 818452 50626130 ~ 50637048 (-)
LOC110534220 LOC106602898 coding downstream 972966 50463950 ~ 50482534 (-)
LOC110534218 LOC106602900 coding downstream 1001215 50452453 ~ 50454285 (-)
LOC110534238 bco2b coding upstream 1154 51457096 ~ 51559902 (-)
LOC110534240 bco2b coding upstream 142685 51598627 ~ 51656987 (-)
adamts15a LOC106602881 coding upstream 633889 52089831 ~ 52124329 (-)
atf5a LOC106602866 coding upstream 820389 52276331 ~ 52281912 (-)
phldb1a LOC106602858 coding upstream 856258 52312200 ~ 52396922 (-)
G900805 NA non-coding downstream 163 51454833 ~ 51455337 (-)
G900817 NA non-coding downstream 35923 51419238 ~ 51419577 (-)
G900816 NA non-coding downstream 36664 51418616 ~ 51418836 (-)
G900813 NA non-coding downstream 39332 51415967 ~ 51416168 (-)
G900809 NA non-coding downstream 43680 51411339 ~ 51411820 (-)
G900920 NA non-coding upstream 139101 51595043 ~ 51595578 (-)
G900956 NA non-coding upstream 202504 51658446 ~ 51658682 (-)
G901027 NA non-coding upstream 303224 51759166 ~ 51766002 (-)
G901153 NA non-coding upstream 388018 51843960 ~ 51853430 (-)
G901191 NA non-coding upstream 446766 51902708 ~ 51902970 (-)
G900070 NA other downstream 473750 50970763 ~ 50981750 (-)
G899739 LOC106602890 other downstream 705267 50743158 ~ 50750233 (-)
G899727 NA other downstream 733897 50720986 ~ 50721603 (-)
G899421 NA other downstream 1272712 50182396 ~ 50182788 (-)
G902519 NA other upstream 1446252 52902194 ~ 52937648 (-)
casp3a LOC106602722 other upstream 2416297 53872239 ~ 53878829 (-)
G903619 primpol other upstream 2423602 53879544 ~ 53883773 (-)
cfap97 cfap97 other upstream 2626224 54082166 ~ 54111277 (-)
G904991 NA other upstream 3823557 55279499 ~ 55280341 (-)

Expression


G900807 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G900807 Expression in each Bioproject

Bar chart with 19 bars.
G900807 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network