G904636



Basic Information


Item Value
gene id G904636
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 55245979 ~ 55246394 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1029025
gaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatgcggagacttgattacacacaggtggattgtatttatcatcattagtaatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctggataattttgcacgcccaatttttcagtttttgatttgtt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1029025 True 416 lncRNA 0.42 1 55245979 55246394
Loading

Neighbor


gene id symbol gene type direction distance location
tmem131l LOC106602747 coding upstream 102429 55043454 ~ 55143550 (+)
LOC110534317 mnd1 coding upstream 203943 55015580 ~ 55042036 (+)
trim2a LOC106602744 coding upstream 231424 54948390 ~ 55014555 (+)
fhdc1 LOC106602742 coding upstream 335764 54845361 ~ 54910259 (+)
arfip1 arfp1 coding upstream 416109 54796229 ~ 54829870 (+)
cnga1a LOC106602752 coding downstream 20229 55266623 ~ 55277393 (+)
LOC110533148 tacr3 coding downstream 70056 55316450 ~ 55356923 (+)
LOC110534323 LOC106602753 coding downstream 168118 55414512 ~ 55436186 (+)
suclg1 LOC106602756 coding downstream 199500 55445894 ~ 55467323 (+)
LOC118936709 NA coding downstream 736238 55982632 ~ 55984568 (+)
G904635 NA non-coding upstream 86 55245662 ~ 55245893 (+)
G904628 NA non-coding upstream 1961 55243421 ~ 55244018 (+)
G904588 NA non-coding upstream 71114 55174511 ~ 55174865 (+)
G904576 NA non-coding upstream 89049 55156705 ~ 55156930 (+)
G904575 NA non-coding upstream 89747 55156004 ~ 55156232 (+)
G904639 LOC106602751 non-coding downstream 3486 55249880 ~ 55250213 (+)
G904643 NA non-coding downstream 8380 55254774 ~ 55254991 (+)
G904646 NA non-coding downstream 10353 55256747 ~ 55256979 (+)
G904651 NA non-coding downstream 18210 55264604 ~ 55265096 (+)
G904633 NA non-coding downstream 34120 55280514 ~ 55282713 (+)
G904621 LOC106567469 other upstream 14724 55230899 ~ 55231255 (+)
helt helt other upstream 1266707 53977386 ~ 53980090 (+)
G902840 LOC106602714 other upstream 1571168 53670120 ~ 53674811 (+)
G902707 NA other upstream 1726191 53516107 ~ 53519788 (+)
LOC110534253 hinfp other upstream 2710329 52532434 ~ 52542498 (+)
G904663 NA other downstream 48843 55295237 ~ 55296054 (+)
G906606 LOC100136012 other downstream 1409905 56656299 ~ 56656552 (+)
LOC110534329 LOC106602762 other downstream 1743610 56953710 ~ 56991150 (+)
LOC110534333 LOC106602771 other downstream 1906370 57142719 ~ 57206820 (+)
LOC110534354 NA other downstream 2422188 57645943 ~ 57671502 (+)

Expression


G904636 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G904636 Expression in each Bioproject

Bar chart with 18 bars.
G904636 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network