G905179



Basic Information


Item Value
gene id G905179
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 55531379 ~ 55531624 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1029598
CCAGCTCCCTCTCCAAGGCTATCTGCAATGACTCAGGATGAGCCAGCTGGATCTGTATGCGCAGCTCCGTAGGAGAGGGCGCCTGTATGAACTGGTCCCGTGCTAGCTCACTCTGCACGGAGGGGGGCATGCTCACATGCCCGCCGAGACAGACTCTCAATGTCATTAGCTAGTACCCGTAGAGGCTCTCCAGGCTGCCTGCGTCTATTACTCAGTTCGGAGCGCAGTGGCCCGGGCTGTACACTC

Function


NR:

description
PREDICTED: latrophilin-like protein LAT-2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1029598 True 246 lncRNA 0.59 1 55531379 55531624

Neighbor


gene id symbol gene type direction distance location
suclg1 LOC106602756 coding upstream 64056 55445894 ~ 55467323 (+)
LOC110534323 LOC106602753 coding upstream 95193 55414512 ~ 55436186 (+)
LOC110533148 tacr3 coding upstream 174456 55316450 ~ 55356923 (+)
cnga1a LOC106602752 coding upstream 253986 55266623 ~ 55277393 (+)
tmem131l LOC106602747 coding upstream 387829 55043454 ~ 55143550 (+)
LOC118936709 NA coding downstream 451008 55982632 ~ 55984568 (+)
LOC110534327 LOC106602758 coding downstream 641808 56173432 ~ 56177148 (+)
LOC110534937 NA coding downstream 1143090 56674714 ~ 56676532 (+)
LOC110534328 NA coding downstream 1156061 56687685 ~ 56693360 (+)
LOC118936710 NA coding downstream 1168634 56700258 ~ 56707998 (+)
G905178 LOC106611608 non-coding upstream 1496 55529657 ~ 55529883 (+)
G905174 LOC106611607 non-coding upstream 3459 55527705 ~ 55527920 (+)
G905171 NA non-coding upstream 4839 55526310 ~ 55526540 (+)
G905169 NA non-coding upstream 6275 55524811 ~ 55525104 (+)
G904657 NA non-coding upstream 242317 55288640 ~ 55289062 (+)
G905210 NA non-coding downstream 22711 55554335 ~ 55554590 (+)
G905215 NA non-coding downstream 28227 55559851 ~ 55560130 (+)
G905424 NA non-coding downstream 202114 55733738 ~ 55740330 (+)
G905439 NA non-coding downstream 215813 55747437 ~ 55747826 (+)
G905548 NA non-coding downstream 311750 55843374 ~ 55843640 (+)
G904663 NA other upstream 235325 55295237 ~ 55296054 (+)
G904621 LOC106567469 other upstream 300124 55230899 ~ 55231255 (+)
helt helt other upstream 1552107 53977386 ~ 53980090 (+)
G902840 LOC106602714 other upstream 1856568 53670120 ~ 53674811 (+)
G902707 NA other upstream 2011591 53516107 ~ 53519788 (+)
G906606 LOC100136012 other downstream 1124675 56656299 ~ 56656552 (+)
LOC110534329 LOC106602762 other downstream 1458380 56953710 ~ 56991150 (+)
LOC110534333 LOC106602771 other downstream 1621140 57142719 ~ 57206820 (+)
LOC110534354 NA other downstream 2136958 57645943 ~ 57671502 (+)
ankrd49 LOC106602680 other downstream 2925358 58456982 ~ 58517975 (+)

Expression


G905179 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G905179 Expression in each Bioproject

Bar chart with 16 bars.
G905179 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network