G909581



Basic Information


Item Value
gene id G909581
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 59624751 ~ 59638698 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1034566
atcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtctgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcaatgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaataatcagtcatat

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1034566 True 384 TUCP 0.45 2 59624751 59638698
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110534398 LOC106602548 coding upstream 67157 59554626 ~ 59557594 (+)
trnat-agu-3 NA coding upstream 74995 59549683 ~ 59549756 (+)
LOC110534401 NA coding upstream 78216 59544551 ~ 59546535 (+)
LOC110534399 LOC106602650 coding upstream 80302 59540280 ~ 59544449 (+)
LOC110534395 LOC106602650 coding upstream 101580 59512421 ~ 59523171 (+)
LOC110534404 LOC106602550 coding downstream 3282 59641980 ~ 59648505 (+)
LOC110534405 LOC106602553 coding downstream 20912 59659610 ~ 59697075 (+)
LOC118937067 NA coding downstream 334406 59973104 ~ 59973159 (+)
LOC110534409 LOC106602556 coding downstream 597467 60236165 ~ 60334139 (+)
LOC110534410 LOC106602558 coding downstream 1039676 60678374 ~ 60741479 (+)
G909578 NA non-coding upstream 3808 59619549 ~ 59620943 (+)
G909543 NA non-coding upstream 17495 59594456 ~ 59607256 (+)
G909485 NA non-coding upstream 88326 59503760 ~ 59536425 (+)
G909504 NA non-coding upstream 93979 59462189 ~ 59530772 (+)
G909544 NA non-coding downstream 10405 59649103 ~ 59649878 (+)
G909588 NA non-coding downstream 15413 59654111 ~ 59654480 (+)
G909589 NA non-coding downstream 16299 59654997 ~ 59655280 (+)
G909532 NA non-coding downstream 65511 59704209 ~ 59705369 (+)
G909715 NA non-coding downstream 246931 59885629 ~ 59940181 (+)
LOC110534381 cldnd other upstream 215808 59401708 ~ 59408944 (+)
ankrd49 LOC106602680 other upstream 1106776 58456982 ~ 58517975 (+)
LOC110534354 NA other upstream 1953295 57645943 ~ 57671502 (+)
LOC110534333 LOC106602771 other upstream 2419665 57142719 ~ 57206820 (+)
G911148 LOC106602559 other downstream 1103606 60742304 ~ 60755677 (+)
LOC110533174 LOC106602527 other downstream 1512566 61146124 ~ 61185835 (+)
G911611 LOC106609905 other downstream 1927659 61566357 ~ 61569062 (+)
si:dkey-9i23.4 LOC106596523 other downstream 2011059 61649733 ~ 61659500 (+)
G911652 NA other downstream 2018629 61657327 ~ 61658426 (+)

Expression


G909581 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G909581 Expression in each Bioproject

Bar chart with 20 bars.
G909581 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network