G911787



Basic Information


Item Value
gene id G911787
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 61925123 ~ 61925403 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1036949
gcaaagaggcactgagtttgaaggtaggccttgaaaaacatccacaggtattcctccaattgactcaaattatgtcaattagcctatcagaagcttctacagccatgacattttttggaattttccaagctgtttaaaggcacagtcaacttagtgtatgtaaacttctgacccaatggaattgagatacagacagattatttcactgtaaacaattgctggaaaaaattacttgcgtcatgcacaaagtagatgtcctaaccgactttccaaaactatag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1036949 True 281 lncRNA 0.38 1 61925123 61925403

Neighbor


gene id symbol gene type direction distance location
LOC110534454 LOC106602593 coding upstream 15855 61890479 ~ 61909268 (+)
LOC118936725 LOC106602589 coding upstream 48124 61869653 ~ 61876999 (+)
tmem132a LOC106602589 coding upstream 56923 61860456 ~ 61868200 (+)
LOC110534451 LOC106602649 coding upstream 71817 61848154 ~ 61853306 (+)
LOC110534447 LOC106602588 coding upstream 80388 61835024 ~ 61844735 (+)
LOC110533179 LOC106602594 coding downstream 6552 61931955 ~ 61939543 (+)
LOC110534457 cplx1 coding downstream 64368 61989771 ~ 62000427 (+)
LOC110533181 LOC106602599 coding downstream 128006 62053409 ~ 62057954 (+)
LOC110534462 LOC106602598 coding downstream 144860 62070263 ~ 62079303 (+)
LOC110534464 LOC106610074 coding downstream 231221 62156624 ~ 62272182 (+)
G911784 NA non-coding upstream 5837 61918984 ~ 61919286 (+)
G911781 NA non-coding upstream 15202 61909445 ~ 61909921 (+)
G911749 NA non-coding upstream 68833 61855973 ~ 61856290 (+)
G911729 NA non-coding upstream 126458 61798421 ~ 61798665 (+)
G911728 NA non-coding upstream 128871 61796047 ~ 61796252 (+)
G911770 NA non-coding downstream 15020 61940423 ~ 61940803 (+)
G911807 NA non-coding downstream 52312 61977715 ~ 61985410 (+)
G911811 NA non-coding downstream 62715 61988118 ~ 61988350 (+)
G911851 NA non-coding downstream 121837 62047240 ~ 62047655 (+)
G911846 NA non-coding downstream 124363 62049766 ~ 62050058 (+)
G911667 NA other upstream 233485 61691269 ~ 61691638 (+)
si:dkey-9i23.4 LOC106596523 other upstream 265623 61649733 ~ 61659500 (+)
G911652 NA other upstream 266697 61657327 ~ 61658426 (+)
G911611 LOC106609905 other upstream 356061 61566357 ~ 61569062 (+)
LOC110533174 LOC106602527 other upstream 742853 61146124 ~ 61185835 (+)
G912025 LOC106602626 other downstream 312574 62237977 ~ 62335475 (+)
LOC110534674 LOC106602611 other downstream 520207 62445576 ~ 62449042 (+)
LOC110534616 LOC106610074 other downstream 611053 62398688 ~ 63503034 (+)
G911920 zn271 other downstream 615397 62540800 ~ 62591739 (+)
LOC110534617 LOC106602493 other downstream 778556 62703911 ~ 62726488 (+)

Expression


G911787 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G911787 Expression in each Bioproject

Bar chart with 9 bars.
G911787 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network