G915476



Basic Information


Item Value
gene id G915476
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 64726057 ~ 64726286 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1041123
AGTATAATGTGAGTTCTCAGTAGGCCTCTGTGTAAAGTATGAGCTTGGAAAAATGATACACCAGGAGAGGCTATGTTGATTGTGTTAAATGGTCTGGGCTTCCACCCATCCTCTTCAAAGTGGTGATGACAGAGATCAGTCTATCTCTCCTGGAAACATCCTGGAAACATTTTGTGCCCGATGTGCTTCTCTACATAACAACAGTAACTAAGGACAGGAGTGTTTAGAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1041123 True 230 lncRNA 0.43 1 64726057 64726286

Neighbor


gene id symbol gene type direction distance location
LOC110534481 LOC106602441 coding upstream 451527 64239200 ~ 64274530 (+)
trnak-cuu-5 NA coding upstream 556726 64169259 ~ 64169331 (+)
si:ch211-89o9.6 LOC106602402 coding upstream 557039 64152774 ~ 64169018 (+)
LOC110534702 LOC106610075 coding upstream 583885 64129558 ~ 64142172 (+)
LOC110534482 vegfc coding downstream 457116 65183402 ~ 65235357 (+)
asb5b LOC106602379 coding downstream 548146 65274432 ~ 65289182 (+)
LOC110534487 LOC106602380 coding downstream 603254 65329540 ~ 65408744 (+)
LOC118936727 NA coding downstream 686763 65413049 ~ 65433465 (+)
LOC118936932 NA coding downstream 761749 65488035 ~ 65494902 (+)
G915471 NA non-coding upstream 4526 64721003 ~ 64721531 (+)
G913223 NA non-coding upstream 11390 64714067 ~ 64714667 (+)
G913217 NA non-coding upstream 26805 64699043 ~ 64699252 (+)
G913216 NA non-coding upstream 28692 64697150 ~ 64697365 (+)
G913214 NA non-coding upstream 32250 64693466 ~ 64693807 (+)
G915662 NA non-coding downstream 310842 65037128 ~ 65037425 (+)
G915905 NA non-coding downstream 403122 65129408 ~ 65129905 (+)
G916080 NA non-coding downstream 552046 65278332 ~ 65283891 (+)
G916090 LOC106602375 non-coding downstream 575325 65301611 ~ 65301858 (+)
G916091 NA non-coding downstream 575598 65301884 ~ 65302159 (+)
G913133 NA other upstream 184672 64540049 ~ 64541385 (+)
G912898 NA other upstream 562799 64162400 ~ 64163258 (+)
G911970 LOC106602434 other upstream 616736 64080084 ~ 64109321 (+)
LOC110534652 zn271 other upstream 806749 63914159 ~ 63944741 (+)
G915549 NA other downstream 111813 64838099 ~ 64839321 (+)
G916075 LOC106602378 other downstream 546316 65272602 ~ 65273761 (+)
G916281 NA other downstream 726816 65453102 ~ 65453500 (+)
LOC110533186 LOC106610166 other downstream 900773 65522742 ~ 65632123 (+)
LOC110534496 LOC106602387 other downstream 1106180 65811359 ~ 65841626 (+)

Expression


G915476 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G915476 Expression in each Bioproject

Bar chart with 9 bars.
G915476 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network