G916090 (LOC106602375)



Basic Information


Item Value
gene id G916090
gene name LOC106602375
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 65301611 ~ 65301858 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1041781
CTCCAGTGATGAACATGCCGGGTGCACTGGGGACCCAGGCCAGACACTGTACAGAGGCAGCTGAACTGGGGAAGCTGAAGGTAGTGACACAGGTGAGCCCCTCTGAGTCGACCATTCGGATGCCATTATGCTGGTTGGCCACTAGGAGGTAGTCTGTAGACAGGGGATCCCACTCCAACGCTGTGACCGGGTCCTCCTCGTCCGTCCCCTCTAAAGACTCTGGGCGCAACACGTGCTTCTGGTTTTTA

Function


NR:

description
hypothetical protein cypCar_00042983, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1041781 True 248 lncRNA 0.58 1 65301611 65301858
Loading

Neighbor


gene id symbol gene type direction distance location
asb5b LOC106602379 coding upstream 12429 65274432 ~ 65289182 (+)
LOC110534482 vegfc coding upstream 66254 65183402 ~ 65235357 (+)
LOC110534481 LOC106602441 coding upstream 1027081 64239200 ~ 64274530 (+)
trnak-cuu-5 NA coding upstream 1132280 64169259 ~ 64169331 (+)
si:ch211-89o9.6 LOC106602402 coding upstream 1132593 64152774 ~ 64169018 (+)
LOC110534487 LOC106602380 coding downstream 27682 65329540 ~ 65408744 (+)
LOC118936727 NA coding downstream 111191 65413049 ~ 65433465 (+)
LOC118936932 NA coding downstream 186177 65488035 ~ 65494902 (+)
LOC110533186 LOC106610166 coding downstream 220884 65522742 ~ 65632123 (+)
LOC110534489 LOC106602382 coding downstream 330989 65632847 ~ 65658686 (+)
G916080 NA non-coding upstream 17720 65278332 ~ 65283891 (+)
G915905 NA non-coding upstream 171706 65129408 ~ 65129905 (+)
G915662 NA non-coding upstream 264186 65037128 ~ 65037425 (+)
G915476 NA non-coding upstream 575325 64726057 ~ 64726286 (+)
G915471 NA non-coding upstream 580080 64721003 ~ 64721531 (+)
G916091 NA non-coding downstream 26 65301884 ~ 65302159 (+)
G916109 NA non-coding downstream 23502 65325360 ~ 65325589 (+)
G916111 NA non-coding downstream 25065 65326923 ~ 65327212 (+)
G916117 NA non-coding downstream 37796 65339654 ~ 65340843 (+)
G916254 NA non-coding downstream 133765 65435623 ~ 65435950 (+)
G916075 LOC106602378 other upstream 27850 65272602 ~ 65273761 (+)
G915549 NA other upstream 462290 64838099 ~ 64839321 (+)
G913133 NA other upstream 760226 64540049 ~ 64541385 (+)
G912898 NA other upstream 1138353 64162400 ~ 64163258 (+)
G916281 NA other downstream 151244 65453102 ~ 65453500 (+)
LOC110534496 LOC106602387 other downstream 530608 65811359 ~ 65841626 (+)
G916697 NA other downstream 783291 66085149 ~ 66085737 (+)
G917796 LOC106602395 other downstream 1455263 66757121 ~ 66757986 (+)

Expression


G916090(LOC106602375) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G916090(LOC106602375) Expression in each Bioproject

Bar chart with 3 bars.
G916090(LOC106602375) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.

Co-expression Network