G916488



Basic Information


Item Value
gene id G916488
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 65765742 ~ 65767743 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1042242
ttttgttctgtatctatggacgtgaccccgtcattcagtctttttgttctgtatctatggacgtgacccgtcattcagtctttttgttctgtatctatggacgtgacccgtcattcagtctttttgttctgtatctatggacgtgacctagtcgttcagtctttttgttctgtatctatggacgtgaccccgtcattcagtctttttgttctgtatctatggacgtgacccgtcattcagtctttttgttctgtgtctatggacgtgacctagtcgttcagtctttttgttctgtatctatggacgtgacctagtcgttcagtctttttgttctgtatctatggacgtgacccctcgttcagtctttttgttctgtatctatggacgtgacccgtcattcagtctttttgttctgtatctatggacgtgaccccgtcattcagtctttttgttctgtatcta

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1042242 True 462 lncRNA 0.42 3 65765742 65767743

Neighbor


gene id symbol gene type direction distance location
LOC110534492 LOC106610168 coding upstream 56225 65696361 ~ 65709517 (+)
LOC110534493 NA coding upstream 76622 65680182 ~ 65690652 (+)
LOC110534489 LOC106602382 coding upstream 107056 65632847 ~ 65658686 (+)
LOC110533186 LOC106610166 coding upstream 133619 65522742 ~ 65632123 (+)
LOC118936932 NA coding upstream 270840 65488035 ~ 65494902 (+)
LOC110534495 LOC106610170 coding downstream 36826 65804569 ~ 65806761 (+)
LOC110534496 LOC106602387 coding downstream 43616 65811359 ~ 65841626 (+)
LOC110534497 LOC106602389 coding downstream 77695 65845438 ~ 65847857 (+)
LOC110534507 LOC106610175 coding downstream 576237 66343980 ~ 66357223 (+)
LOC110534508 fbxw7 coding downstream 706372 66474115 ~ 66567984 (+)
G916431 NA non-coding upstream 148607 65616086 ~ 65617135 (+)
G916369 NA non-coding upstream 250320 65515207 ~ 65515422 (+)
G916366 NA non-coding upstream 251819 65513699 ~ 65513923 (+)
G916364 NA non-coding upstream 252256 65513012 ~ 65513486 (+)
G916707 NA non-coding downstream 345372 66113115 ~ 66113501 (+)
G916715 NA non-coding downstream 365945 66133688 ~ 66133916 (+)
G916717 NA non-coding downstream 367774 66135517 ~ 66135740 (+)
G917126 NA non-coding downstream 383771 66151514 ~ 66151761 (+)
G917204 NA non-coding downstream 441537 66209280 ~ 66209557 (+)
G916281 NA other upstream 312242 65453102 ~ 65453500 (+)
G916075 LOC106602378 other upstream 491981 65272602 ~ 65273761 (+)
G915549 NA other upstream 926421 64838099 ~ 64839321 (+)
G913133 NA other upstream 1224357 64540049 ~ 64541385 (+)
G916697 NA other downstream 317406 66085149 ~ 66085737 (+)
G917796 LOC106602395 other downstream 989378 66757121 ~ 66757986 (+)
G917798 LOC106613263 other downstream 991541 66759284 ~ 66759753 (+)
LOC110533189 LOC106610178 other downstream 1090746 66858457 ~ 67246560 (+)

Expression


G916488 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G916488 Expression in each Bioproject

Bar chart with 15 bars.
G916488 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network