G917323



Basic Information


Item Value
gene id G917323
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 66360540 ~ 66360827 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1043152
GCAGTGTATGGTAGTTGACCTCAGACGGCTTCATATGTAACCTTCATGAAAGCGGTGTATGGTAATTGACCTCAGACGGCTTCATATGTAACCTTCATGACAGCCTGCAGTGTATGGTAGTTGGTCTTAGACTGCTTCATATGTAACCTTCATGACAGCAGTGTATGGTAGTTGGCCTCAGACTGCTTTATATGTAACCTTCATGACAGCGGTGTATGGTAGTTGACCTCAGACTGCTTCATATGTAACCTTCATGACAGCAGTGTATGGTAGTTGACCTCAGACTGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1043152 True 288 lncRNA 0.45 1 66360540 66360827
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110534507 LOC106610175 coding upstream 3317 66343980 ~ 66357223 (+)
LOC110534497 LOC106602389 coding upstream 512683 65845438 ~ 65847857 (+)
LOC110534496 LOC106602387 coding upstream 518919 65811359 ~ 65841626 (+)
LOC110534495 LOC106610170 coding upstream 553779 65804569 ~ 65806761 (+)
LOC110534492 LOC106610168 coding upstream 651023 65696361 ~ 65709517 (+)
LOC110534508 fbxw7 coding downstream 113288 66474115 ~ 66567984 (+)
LOC110534511 gatb coding downstream 366249 66727076 ~ 66749969 (+)
LOC110534512 LOC106610182 coding downstream 458281 66819108 ~ 66843648 (+)
LOC110533189 LOC106610178 coding downstream 497630 66858457 ~ 67246560 (+)
mrb mrb coding downstream 1031877 67392704 ~ 67490835 (+)
G917204 NA non-coding upstream 150983 66209280 ~ 66209557 (+)
G917126 NA non-coding upstream 208779 66151514 ~ 66151761 (+)
G916717 NA non-coding upstream 224800 66135517 ~ 66135740 (+)
G916715 NA non-coding upstream 226624 66133688 ~ 66133916 (+)
G916707 NA non-coding upstream 247039 66113115 ~ 66113501 (+)
G917251 NA non-coding downstream 4553 66365380 ~ 66445972 (+)
G917614 NA non-coding downstream 222193 66583020 ~ 66583330 (+)
G917620 NA non-coding downstream 225747 66586574 ~ 66591173 (+)
G917633 NA non-coding downstream 242426 66603253 ~ 66603598 (+)
G917634 NA non-coding downstream 243445 66604272 ~ 66604609 (+)
G916697 NA other upstream 274803 66085149 ~ 66085737 (+)
LOC110533186 LOC106610166 other upstream 728553 65522742 ~ 65632123 (+)
G916281 NA other upstream 907040 65453102 ~ 65453500 (+)
G916075 LOC106602378 other upstream 1086779 65272602 ~ 65273761 (+)
G917796 LOC106602395 other downstream 396294 66757121 ~ 66757986 (+)
G917798 LOC106613263 other downstream 398457 66759284 ~ 66759753 (+)
G918009 NA other downstream 848110 67208937 ~ 67211240 (+)
G918319 NA other downstream 886255 67247082 ~ 67252193 (+)

Expression


G917323 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G917323 Expression in each Bioproject

Bar chart with 12 bars.
G917323 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network