G925413



Basic Information


Item Value
gene id G925413
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 75800949 ~ 75802388 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1052818
acactactctacactactctactctactctacactactctacactactctacactactctacactactctacactactctactctacactactctacactactctacagtaaactacactacactactctactctacactactctacactactctactctacactacactactctacactactctactctacactactctacactactctacactactctactctactctacactactctacactactctacactactctacactactctactctacactactctacactactctacagtaaactacactacactactctactctacactactctacactactctactctacactacactacactactctacactactctactctacactactctactctacactactctacactacactacactactctacactactctactctacactactctacactacactacactactctacactacactactctacactacactactctactctacact

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1052818 True 515 lncRNA 0.40 2 75800949 75802388
Loading

Neighbor


gene id symbol gene type direction distance location
pcdh7a LOC103353181 coding downstream 155578 75561915 ~ 75645371 (-)
LOC110511405 NA coding downstream 306806 75491540 ~ 75494143 (-)
LOC118936770 LOC105006021 coding downstream 388055 75403643 ~ 75412894 (-)
LOC118936693 LOC106592283 coding downstream 599483 75136124 ~ 75201466 (-)
LOC118936366 LOC106566139 coding downstream 744775 75053116 ~ 75056174 (-)
LOC110513050 LOC106610486 coding upstream 577879 76380267 ~ 76417797 (-)
LOC110497198 LOC106602151 coding upstream 1059661 76862049 ~ 76870007 (-)
LOC110497205 LOC106610372 coding upstream 1256034 77058422 ~ 77138155 (-)
LOC118936771 LOC106592107 coding upstream 1347532 77149546 ~ 77175471 (-)
LOC110515566 LOC100700017 coding upstream 1406121 77208509 ~ 77247484 (-)
G925401 NA non-coding downstream 1971 75761767 ~ 75798978 (-)
G925399 NA non-coding downstream 26126 75760002 ~ 75774823 (-)
G925402 NA non-coding downstream 34099 75765309 ~ 75766850 (-)
G925393 NA non-coding downstream 67450 75732456 ~ 75733499 (-)
G925360 NA non-coding downstream 134304 75664374 ~ 75666645 (-)
G925415 NA non-coding upstream 5529 75807917 ~ 75809743 (-)
G925424 NA non-coding upstream 24729 75827117 ~ 75827322 (-)
G925427 NA non-coding upstream 35724 75838112 ~ 75838312 (-)
G925429 NA non-coding upstream 50042 75852430 ~ 75852633 (-)
G925448 NA non-coding upstream 55273 75857661 ~ 75858624 (-)
G925211 NA other downstream 516276 75283991 ~ 75284673 (-)
LOC118966654 LOC106597013 other downstream 862592 74933999 ~ 74970163 (-)
LOC110517287 LOC106601385 other downstream 882690 74890707 ~ 74932952 (-)
G926001 NA other upstream 593960 76396348 ~ 76399221 (-)
G926732 NA other upstream 1979624 77782012 ~ 77783305 (-)
G927157 timm10 other upstream 2160149 77961348 ~ 77963652 (-)
G927317 LOC106610497 other upstream 2579881 78382269 ~ 78434096 (-)
G927222 LOC106610501 other upstream 2638917 78441305 ~ 78441982 (-)

Expression


G925413 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G925413 Expression in each Bioproject

Bar chart with 11 bars.
G925413 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network