G928620



Basic Information


Item Value
gene id G928620
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 80730040 ~ 80737865 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1057146
ctaggtggtgtggtatcagactaggtgatgtggtatcaggctaggtggtgtggtatcagactaggtggtgtggtatcaggctaggtgatgtggtatcaggctaggtggtgtggtatcagactaggtggtgtggtatcaggctaggtgatgtggtatcaggctaggtggtgtggtatcaggggtggtgtggtatcagactaggtggtgtggtatcaggctaggtggtgtggtatcagactagatggtgtggtatcaggctaggtggtgtggtatcagactaggtggtgtggtatcaggctaggtggtgtggtatcagactaggtggtgtggtatcaggctaggtggtgtggtatcagactaggtggtgtggtatcaggggtggtgtggtatcagactagatggtgtggtatcaggctaggtggtgttgtatcagactaggtggtgtggtatcag

Function


NR:

description
keratin-associated protein 4-6-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1057146 True 453 lncRNA 0.52 4 80730040 80737865
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936381 LOC105020813 coding upstream 16276 80691018 ~ 80713764 (+)
LOC110516989 LOC103383728 coding upstream 78062 80626746 ~ 80651979 (+)
LOC110497187 LOC106610426 coding upstream 364854 80361027 ~ 80365186 (+)
LOC110516353 LOC106610561 coding upstream 371962 80353937 ~ 80358078 (+)
LOC118936798 LOC106610412 coding upstream 708336 80016957 ~ 80021704 (+)
trnae-cuc-165 NA coding downstream 192231 80930096 ~ 80930167 (+)
LOC118936804 NA coding downstream 197348 80935213 ~ 80936319 (+)
LOC110514786 LOC106592710 coding downstream 204680 80942545 ~ 81014251 (+)
LOC110530284 LOC106592313 coding downstream 480110 81217975 ~ 81220397 (+)
LOC118936811 LOC106593215 coding downstream 503769 81239097 ~ 81247351 (+)
G928595 NA non-coding upstream 7784 80721496 ~ 80722256 (+)
G928593 NA non-coding upstream 8999 80720525 ~ 80721041 (+)
G928500 NA non-coding upstream 53409 80676023 ~ 80676631 (+)
G928496 NA non-coding upstream 60288 80668758 ~ 80669752 (+)
G928490 NA non-coding upstream 69285 80659379 ~ 80660755 (+)
G928622 NA non-coding downstream 3281 80741146 ~ 80752064 (+)
G928626 NA non-coding downstream 9654 80747519 ~ 80747836 (+)
G928639 NA non-coding downstream 51669 80789534 ~ 80790410 (+)
G928643 NA non-coding downstream 61052 80798917 ~ 80799437 (+)
G928645 NA non-coding downstream 80985 80818850 ~ 80819623 (+)
G928335 NA other upstream 413471 80311944 ~ 80316569 (+)
G928206 NA other upstream 701821 80027002 ~ 80028219 (+)
LOC110532970 LOC105020822 other upstream 972996 79727045 ~ 79782057 (+)
LOC110514189 LOC106593948 other upstream 1129268 79597075 ~ 79601686 (+)
G927606 NA other upstream 1445896 79281386 ~ 79284144 (+)
LOC110515606 LOC106597156 other downstream 83799 80723535 ~ 80922638 (+)
G928731 NA other downstream 381700 81119565 ~ 81120877 (+)
G928705 LOC106594836 other downstream 447020 81067884 ~ 81313748 (+)
G928757 NA other downstream 539174 81277039 ~ 81330349 (+)

Expression


G928620 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G928620 Expression in each Bioproject

Bar chart with 10 bars.
G928620 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network