G929026



Basic Information


Item Value
gene id G929026
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 81924096 ~ 81926908 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1057721
aaccactagactacctacctcctctacactctaaccactagactacctgcctcctctacactctaaccactaggctaccctgccgcctctacactctaaccactagtctacctgcctcctctacactctaaccactaggctacctgcctcctctacactctaaccactaggctaccctgccacctctacactctaaccactagactacctgcctcctctacactctaaccactagactacctgcctcctct
>TU1057722
aaccactagactacctacctcctctacactctaaccactagactacctgcctcctctacactctaaccactaggctaccctgcctcctctacactctaaccactagtctacctgcctcctctacactctaaccactaggctacctgcctcctctacactctaaccactaggctacctgcctcctctacactctaaccactaggctacctgcctcctctacactctaaccactagaatacctgcctcctctacactctaaccactaggctacctgccacctctacactctaaccactaggctacctgcctcctctacactctaaccactaggctacctgcctcctctacactctaaccactaggctacctgcctcctctacactctaaccactagactacctgc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1057721 False 251 lncRNA 0.52 3 81924096 81926908
TU1057722 True 403 lncRNA 0.52 2 81924096 81925332
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110515659 NA coding upstream 169099 81750222 ~ 81754997 (+)
LOC110514629 melk coding upstream 178251 81721230 ~ 81745845 (+)
LOC118936820 NA coding upstream 238657 81682434 ~ 81685439 (+)
LOC118936819 LOC106602658 coding upstream 251758 81617460 ~ 81672338 (+)
LOC118936818 LOC106576580 coding upstream 308767 81558744 ~ 81615329 (+)
LOC118936822 NA coding downstream 2237 81929145 ~ 81942287 (+)
LOC118936939 NA coding downstream 37176 81964084 ~ 81965938 (+)
LOC118936823 pgm2 coding downstream 53886 81980794 ~ 81986434 (+)
LOC118936694 tbc1d1 coding downstream 70513 81997421 ~ 82120937 (+)
LOC118936825 LOC106593007 coding downstream 246423 82173331 ~ 82211022 (+)
G929025 NA non-coding upstream 106 81923616 ~ 81923990 (+)
G929023 NA non-coding upstream 7630 81916177 ~ 81916466 (+)
G929022 NA non-coding upstream 9554 81913318 ~ 81914542 (+)
G929021 NA non-coding upstream 11586 81912288 ~ 81912510 (+)
G929020 NA non-coding upstream 12730 81910626 ~ 81911366 (+)
G929031 NA non-coding downstream 6210 81933118 ~ 81933319 (+)
G929040 NA non-coding downstream 31492 81958400 ~ 81959272 (+)
G929042 NA non-coding downstream 34822 81961730 ~ 81962893 (+)
G929046 NA non-coding downstream 42262 81969170 ~ 81969403 (+)
G928929 NA other upstream 269705 81653391 ~ 81654391 (+)
LOC110513527 LOC106595035 other upstream 394214 81526514 ~ 81534991 (+)
G929033 NA other downstream 21202 81948110 ~ 81961513 (+)
G929113 NA other downstream 252878 82179786 ~ 82180426 (+)
LOC110510824 LOC106594418 other downstream 286972 82212448 ~ 82232976 (+)
LOC118936827 LOC106591767 other downstream 365042 82261288 ~ 82306725 (+)

Expression


G929026 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G929026 Expression in each Bioproject

Bar chart with 20 bars.
G929026 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network