G929904



Basic Information


Item Value
gene id G929904
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 82047437 ~ 82049708 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1058997
AAACTGTCTCAATAAAGACACAATGTCCACTAGGCTTTAAACTGTCTCAATAAAGACAGAATGTCCACTAGGCTTTAAACTGTCTCAATAAAGACAGAATGTCCACTAGGCTTTAAAACTGTCTCAATAAAGACAATGTCCACTAGGCTTTAAAACTGTCTCAATAAAGACAATGTCCACTAGGCTTTAAAACTGTCTCAATAAAGACA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1058997 True 209 lncRNA 0.35 3 82047437 82049708
Loading

Neighbor


gene id symbol gene type direction distance location
pax-5 pax-5 coding downstream 113227 81801697 ~ 81934210 (-)
LOC110511793 NA coding downstream 245780 81800264 ~ 81801657 (-)
LOC110516879 LOC106595306 coding downstream 335170 81682503 ~ 81712267 (-)
LOC110513528 LOC106592840 coding downstream 490677 81542030 ~ 81556760 (-)
LOC118936816 NA coding downstream 522039 81506173 ~ 81525398 (-)
LOC118936824 NA coding upstream 24744 82074452 ~ 82074728 (-)
trnap-agg-151 NA coding upstream 162099 82211807 ~ 82211878 (-)
LOC118936826 NA coding upstream 183363 82233071 ~ 82260736 (-)
LOC118936940 NA coding upstream 489210 82538918 ~ 82540157 (-)
LOC110515655 rfc1 coding upstream 577862 82627113 ~ 82698838 (-)
G929894 NA non-coding downstream 19114 82022516 ~ 82028323 (-)
G929893 NA non-coding downstream 22129 82021548 ~ 82025308 (-)
G929888 NA non-coding downstream 33035 82010574 ~ 82014402 (-)
G929880 NA non-coding downstream 49340 81997461 ~ 81998097 (-)
G929867 LOC106594399 non-coding downstream 60836 81981150 ~ 81986601 (-)
G929909 NA non-coding upstream 10560 82060268 ~ 82060846 (-)
G929918 NA non-coding upstream 25630 82075338 ~ 82075916 (-)
G929919 NA non-coding upstream 45188 82094896 ~ 82103254 (-)
G929922 NA non-coding upstream 61914 82111622 ~ 82112584 (-)
G929928 NA non-coding upstream 81302 82131010 ~ 82131211 (-)
G929783 NA other downstream 408017 81637925 ~ 81639420 (-)
G929726 NA other downstream 657938 81388740 ~ 81389499 (-)
G929725 NA other downstream 666853 81379773 ~ 81380584 (-)
LOC110510685 LOC106590958 other downstream 727989 81312816 ~ 81329120 (-)
LOC118936810 LOC106596791 other downstream 753758 81285870 ~ 81294695 (-)
G929913 NA other upstream 30173 82079881 ~ 82082138 (-)
G929889 NA other upstream 58716 82108424 ~ 82109749 (-)
G929926 NA other upstream 68309 82118017 ~ 82118576 (-)
G929912 NA other upstream 70760 82120468 ~ 82120984 (-)
G929952 NA other upstream 141285 82190993 ~ 82196992 (-)

Expression


G929904 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G929904 Expression in each Bioproject

Bar chart with 9 bars.
G929904 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network