G929182



Basic Information


Item Value
gene id G929182
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 82412005 ~ 82412680 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1057973
GTGCATATTTTCTCATCTGAGAGGTCTACAGGTCCTAGCTGACACAACGTCTCTGATATTCTCAGGTAGGAAGCAGCTTCGGTGAATTTGATTGTCATGATTGCTTGTTCAAATTGTACATACAGTTTTCTTCCTATTTCAAGACATTAGTCGTCTTAGACCTACCTATGCAACTGAAAGCTCCATCTGTTATTAACGGGATGCTATAGGTGTAAACCCATAGATGTAGGTTAACTGTTGAAATCTGTTATTAACGGGATGCTATAGGTGTAAACCCATAGATGTAGGCTAACTGTTGAAATCTGTTATTAACGGGATGCTATAGGTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1057973 True 328 lncRNA 0.39 2 82412005 82412680
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936828 wdr19 coding upstream 10765 82316721 ~ 82401240 (+)
LOC118936827 LOC106591767 coding upstream 105280 82261288 ~ 82306725 (+)
LOC110510824 LOC106594418 coding upstream 179029 82212448 ~ 82232976 (+)
LOC118936825 LOC106593007 coding upstream 202671 82173331 ~ 82211022 (+)
LOC118936694 tbc1d1 coding upstream 291068 81997421 ~ 82120937 (+)
LOC110512972 lias coding downstream 314735 82727415 ~ 82738670 (+)
LOC118936830 NA coding downstream 328458 82740970 ~ 82780517 (+)
LOC118936832 LOC105009164 coding downstream 380973 82793509 ~ 82811450 (+)
LOC118936833 NA coding downstream 387239 82799919 ~ 82803172 (+)
LOC110512617 n4bp2 coding downstream 493050 82905730 ~ 82956331 (+)
G929172 NA non-coding upstream 25879 82385568 ~ 82386126 (+)
G929171 NA non-coding upstream 33539 82378171 ~ 82378466 (+)
G929139 NA non-coding upstream 42354 82369278 ~ 82369651 (+)
G929164 NA non-coding upstream 93304 82318078 ~ 82318701 (+)
G929162 NA non-coding upstream 95712 82314940 ~ 82316293 (+)
G929184 NA non-coding downstream 2550 82415230 ~ 82419615 (+)
G929186 NA non-coding downstream 4530 82417210 ~ 82419498 (+)
G929195 NA non-coding downstream 32514 82445194 ~ 82445612 (+)
G929200 NA non-coding downstream 46248 82458928 ~ 82562957 (+)
G929208 NA non-coding downstream 59540 82472220 ~ 82477848 (+)
G929159 NA other upstream 102433 82308803 ~ 82309572 (+)
G929305 NA other downstream 348925 82761605 ~ 82762488 (+)
G929370 NA other downstream 622432 83035112 ~ 83035491 (+)

Expression


G929182 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G929182 Expression in each Bioproject

Bar chart with 6 bars.
G929182 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network