G930066


Basic Information

Item Value
gene id G930066
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 82474717 ~ 82476652 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1059271
agttctatacctctagtgaatggtctatagttctttacctctagtgaatggtctatagttatatagttctatacctctagtgaatggtctatagttctatacctctagtgaatggtctatagttctatacctctagtgaatggtctatagttctatacctctagtgaatggtctatagttctatacctctagtgaatggtctatagttctttacctctagtgaatggtctatagttctttacctctagtgaatggtctatagatctttacctctagtgaatggtctatagttctttacctctagtgaatggtctatagttctttacctctagtgaatggtctatagttctatagttctatacctctagtgaatggtctatagttctttacctctagtgaatggtctatagatctatacctctagtgaatggtctatagttctatagttctttacctctagtgaatggtctatagttctgtacctctagtgaatggtctatagttctatagttctttacctctagtgaatggtctatagttctatacctctagtgaatggtctatagttctatacctctagtgaatggtctatagttctatacctctagtgaatggtctatagttctatagttctttacctctagtgaatggtctatagttctatatctctagtgaatggtctatagttctatagttctttacctctagtgaatggtctatagttctatacctctagtgaatggtctatagttctatacctctagtgaatggtctatagttctttacctctagtgaatggtctatagatctttacctctagtgaatggtctatagttctatagatct

Function

NR:

description
PREDICTED: tektin-2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1059271 True 846 lncRNA 0.35 2 82474717 82476652

Neighbor

gene id symbol gene type direction distance location
LOC118936826 NA coding downstream 213981 82233071 ~ 82260736 (-)
trnap-agg-151 NA coding downstream 262839 82211807 ~ 82211878 (-)
LOC118936824 NA coding downstream 399989 82074452 ~ 82074728 (-)
pax-5 pax-5 coding downstream 540507 81801697 ~ 81934210 (-)
LOC110511793 NA coding downstream 673060 81800264 ~ 81801657 (-)
LOC118936940 NA coding upstream 62266 82538918 ~ 82540157 (-)
LOC110515655 rfc1 coding upstream 150918 82627113 ~ 82698838 (-)
rpl9 rpl9 coding upstream 242868 82719520 ~ 82727225 (-)
LOC118936829 ugdh coding upstream 265439 82742091 ~ 82773400 (-)
LOC118936831 smim14 coding upstream 301898 82777425 ~ 82792240 (-)
G930060 NA non-coding downstream 20549 82453627 ~ 82454168 (-)
G930046 NA non-coding downstream 43496 82430683 ~ 82431221 (-)
G930025 NA non-coding downstream 70929 82403528 ~ 82403788 (-)
G930024 NA non-coding downstream 71285 82403197 ~ 82403432 (-)
G930021 NA non-coding downstream 72062 82391315 ~ 82402655 (-)
G930040 NA non-coding upstream 7616 82484268 ~ 82485047 (-)
G930070 NA non-coding upstream 14890 82491542 ~ 82493784 (-)
G930079 NA non-coding upstream 45210 82521862 ~ 82600084 (-)
G930099 NA non-coding upstream 133086 82609738 ~ 82617007 (-)
G930098 NA non-coding upstream 137489 82614141 ~ 82621946 (-)
G929952 NA other downstream 277725 82190993 ~ 82196992 (-)
G929912 NA other downstream 353733 82120468 ~ 82120984 (-)
G929926 NA other downstream 356141 82118017 ~ 82118576 (-)
G929889 NA other downstream 364968 82108424 ~ 82109749 (-)
G930096 NA other upstream 223585 82700237 ~ 82716562 (-)
LOC118936834 pds5a other upstream 337873 82814525 ~ 82905732 (-)
G930187 NA other upstream 561509 83038161 ~ 83038482 (-)

Expression

G930066 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G930066 Expression in each Bioproject

Bar chart with 3 bars.
G930066 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network