G930070



Basic Information


Item Value
gene id G930070
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 82491542 ~ 82493784 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1059279
cagctgctgcaggggtggtggtggtgacagcggctgcaggagcggtggtggtgacagctgctgcaggggcggtggtggtggtaccagctgctgcaggggcggtggtggtggtgacagctgctgcaggggtggtggtggtaacagctgctgcaggagcggtggtggtgacagctgctgcaggagcggtggtggtaccagctgctgcaggagcggtggtggtaccagctgctgcaggggcggtggtg

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1059279 True 245 lncRNA 0.68 2 82491542 82493784

Neighbor


gene id symbol gene type direction distance location
LOC118936826 NA coding downstream 230806 82233071 ~ 82260736 (-)
trnap-agg-151 NA coding downstream 279664 82211807 ~ 82211878 (-)
LOC118936824 NA coding downstream 416814 82074452 ~ 82074728 (-)
pax-5 pax-5 coding downstream 557332 81801697 ~ 81934210 (-)
LOC110511793 NA coding downstream 689885 81800264 ~ 81801657 (-)
LOC118936940 NA coding upstream 45134 82538918 ~ 82540157 (-)
LOC110515655 rfc1 coding upstream 133786 82627113 ~ 82698838 (-)
rpl9 rpl9 coding upstream 225736 82719520 ~ 82727225 (-)
LOC118936829 ugdh coding upstream 248307 82742091 ~ 82773400 (-)
LOC118936831 smim14 coding upstream 284766 82777425 ~ 82792240 (-)
G930040 NA non-coding downstream 6495 82484268 ~ 82485047 (-)
G930035 NA non-coding downstream 6678 82412957 ~ 82484864 (-)
G930066 NA non-coding downstream 14890 82474717 ~ 82476652 (-)
G930060 NA non-coding downstream 37374 82453627 ~ 82454168 (-)
G930046 NA non-coding downstream 60321 82430683 ~ 82431221 (-)
G930079 NA non-coding upstream 28078 82521862 ~ 82600084 (-)
G930099 NA non-coding upstream 115954 82609738 ~ 82617007 (-)
G930098 NA non-coding upstream 120357 82614141 ~ 82621946 (-)
G930105 NA non-coding upstream 132906 82626690 ~ 82626973 (-)
G929952 NA other downstream 294550 82190993 ~ 82196992 (-)
G929912 NA other downstream 370558 82120468 ~ 82120984 (-)
G929926 NA other downstream 372966 82118017 ~ 82118576 (-)
G929889 NA other downstream 381793 82108424 ~ 82109749 (-)
G930096 NA other upstream 206453 82700237 ~ 82716562 (-)
LOC118936834 pds5a other upstream 320741 82814525 ~ 82905732 (-)
G930187 NA other upstream 544377 83038161 ~ 83038482 (-)

Expression


G930070 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G930070 Expression in each Bioproject

Bar chart with 4 bars.
G930070 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network