G930105



Basic Information


Item Value
gene id G930105
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 82626690 ~ 82626973 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1059331
agactattgagatgcacccctaggagacagaactagactattgagatgcacccctaggagacagaactagactattgagatgcacccctaggagacagaactagactattgagatgcacccctaggagacagaactagactattgagatgcacccctaggagacagaactagactattgagatgcacccctaggagacagaactagactattgagatgcacccctaggagacagaactagactattgagatgcacccctaggagaccagactattgagatgcac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1059331 True 284 lncRNA 0.47 1 82626690 82626973
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936940 NA coding downstream 86533 82538918 ~ 82540157 (-)
LOC118936826 NA coding downstream 365954 82233071 ~ 82260736 (-)
trnap-agg-151 NA coding downstream 414812 82211807 ~ 82211878 (-)
LOC118936824 NA coding downstream 551962 82074452 ~ 82074728 (-)
pax-5 pax-5 coding downstream 692480 81801697 ~ 81934210 (-)
LOC110515655 rfc1 coding upstream 597 82627113 ~ 82698838 (-)
rpl9 rpl9 coding upstream 92547 82719520 ~ 82727225 (-)
LOC118936829 ugdh coding upstream 115118 82742091 ~ 82773400 (-)
LOC118936831 smim14 coding upstream 151577 82777425 ~ 82792240 (-)
LOC118936834 pds5a coding upstream 188374 82814525 ~ 82905732 (-)
G930098 NA non-coding downstream 4744 82614141 ~ 82621946 (-)
G930099 NA non-coding downstream 9683 82609738 ~ 82617007 (-)
G930079 NA non-coding downstream 26606 82521862 ~ 82600084 (-)
G930070 NA non-coding downstream 132906 82491542 ~ 82493784 (-)
G930040 NA non-coding downstream 141643 82484268 ~ 82485047 (-)
G930106 NA non-coding upstream 1317 82628290 ~ 82628624 (-)
G930107 NA non-coding upstream 54007 82680980 ~ 82681340 (-)
G930108 NA non-coding upstream 61367 82688340 ~ 82688610 (-)
G930109 NA non-coding upstream 63692 82690665 ~ 82690962 (-)
G929952 NA other downstream 429698 82190993 ~ 82196992 (-)
G929912 NA other downstream 505706 82120468 ~ 82120984 (-)
G929926 NA other downstream 508114 82118017 ~ 82118576 (-)
G929889 NA other downstream 516941 82108424 ~ 82109749 (-)
G930096 NA other upstream 73264 82700237 ~ 82716562 (-)
G930187 NA other upstream 411188 83038161 ~ 83038482 (-)

Expression


G930105 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G930105 Expression in each Bioproject

Bar chart with 10 bars.
G930105 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network