G931467



Basic Information


Item Value
gene id G931467
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 85310697 ~ 85311285 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1061301
gcctcagtgttcacagtaaaactgtaacttaaagcaggtacagtctcagtgttcacagtaaaactgtaacttaaagcaggtacagcctcagtgttcacagtaaaactgtaacttaaagcaggtacagcctcagtgttcacagtaaaactgtaacttaaagcaggtacagtctcagtgttcacagtaaaactgtaacttaaagcaggtacagcctcagtgttcacagtaaaactgtaacttaaagcaggtacagcctcagtgttcacagtaaaactgtaacttaaagcaggtacagcctcagtgttcacagtaaaactgtaacttaaagcaggtacagcctcagtgttcacagtaaaactaacttaaagcaggtacagcctcagtgttcacagtaaaactaacttaaagcaggtacagcctcag

Function


NR:

description
PREDICTED: prespore vesicle protein-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1061301 True 423 lncRNA 0.40 2 85310697 85311285

Neighbor


gene id symbol gene type direction distance location
LOC110515429 LOC106610570 coding upstream 92954 85198005 ~ 85221752 (+)
LOC110517086 LOC106590778 coding upstream 160921 85105137 ~ 85149776 (+)
LOC110516354 LOC106610426 coding upstream 463891 84843532 ~ 84846806 (+)
LOC110498551 LOC106610561 coding upstream 469601 84835276 ~ 84841096 (+)
LOC110514534 LOC106610412 coding upstream 650319 84654783 ~ 84660378 (+)
trnae-cuc-167 NA coding downstream 145139 85456424 ~ 85456495 (+)
LOC118936854 NA coding downstream 154891 85464789 ~ 85466981 (+)
LOC110513232 LOC106594638 coding downstream 160878 85472163 ~ 85594820 (+)
LOC110510945 LOC106591917 coding downstream 252886 85564171 ~ 85594820 (+)
LOC118966668 LOC106592313 coding downstream 582569 85893094 ~ 85950607 (+)
G931464 NA non-coding upstream 8979 85301015 ~ 85301718 (+)
G931455 NA non-coding upstream 41656 85268463 ~ 85269041 (+)
G931454 NA non-coding upstream 50405 85260058 ~ 85260292 (+)
G931450 NA non-coding upstream 57722 85252579 ~ 85252975 (+)
G931449 NA non-coding upstream 59217 85251003 ~ 85251480 (+)
G931474 NA non-coding downstream 24852 85336137 ~ 85336943 (+)
G931478 NA non-coding downstream 38266 85349551 ~ 85349857 (+)
G931493 NA non-coding downstream 121678 85432963 ~ 85433605 (+)
G931494 NA non-coding downstream 126072 85437357 ~ 85445000 (+)
LOC110515949 LOC106591060 non-coding downstream 137069 85236443 ~ 85448659 (+)
G931108 LOC107756720 other upstream 633619 84676559 ~ 84677078 (+)
G930572 LOC106593948 other upstream 1154983 84154939 ~ 84155714 (+)
LOC110515513 LOC106594142 other upstream 1165023 84130437 ~ 84282587 (+)
G931587 NA other downstream 163001 85474286 ~ 85475128 (+)
G931588 NA other downstream 164336 85475621 ~ 85476131 (+)
G931574 LOC106591917 other downstream 205313 85516598 ~ 85592174 (+)

Expression


G931467 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G931467 Expression in each Bioproject

Bar chart with 19 bars.
G931467 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network