LOC110535921 (LOC106579942)


Basic Information

Item Value
gene id LOC110535921
gene name LOC106579942
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 52195783 ~ 52200026 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XM_021621303.2
CAACCACCCAGGGTAGTTTATAGTGACAGCTACCTTGGGTACGCGTCTACGGTGGAGCCCGTTTCCCCCTACATCACTTCCGTTCATCTGATCGGTCAGAAAGACTGCGAAAATGGTGTCTTTTGGAAGAATTTCGCAAGCTCTCCTACGGTCCTCAATAATCCAGACCCGTCAACTCTCTGCCTCAGCGGCCCATAGTCATGGGGAGCAAACAGCCAGAACATGGAAGATCCTCTCCTTTGTAGTTGCCCTTCCGGGGGTTGCAGTGTGCATGTTGAACATGTACCTGAAGATGCAGCAACATGCTGCACACCATGTGGAACCTGAGTTCGTACCTTACAGCCACCTTCGCATTCGCAGCAAGCGTTTCCCATGGGGTGATGGCAACAAGAGCCTGTTCCACAACCCTGAAGTAAATGCCCTCCCTGATGGCTATGAAGGACGTGAAGAATGATCACTCTTCTTCCAGATTACCTCATACACTGGGACCAGAGTCTTCCCTCAATTCTTTACTCTGTTACTAGACCACGCTCTTCAAACAGTTTACACTCCTCTATTCCATTATGTTTAACTATGCATACTTGTCACAAGGGACTCAATGATAGTAAAACCTTTCTGGACCATTTAACACAATGTGTGCTTAAACTTAACTAAAATAAATATTACCAAAATGTGTTTGTCATTATTAACTCA

Function

NR:

description
Cytochrome c oxidase polypeptide VIa, mitochondrial precursor

GO: NA

KEGG:

id description
K02266 COX6A; cytochrome c oxidase subunit 6a

RNA

RNA id representative length rna type GC content exon number start site end site
XM_021621303.2 True 693 mRNA 0.46 3 52195783 52200026
Loading

Neighbor

gene id symbol gene type direction distance location
hps4 hps4 coding downstream 140 52182740 ~ 52195643 (-)
si:ch211-170d8.2 LOC106580253 coding downstream 14112 52179279 ~ 52181671 (-)
pop5 pop5 coding downstream 18097 52169534 ~ 52177686 (-)
rnf10 rnf10 coding downstream 27793 52142821 ~ 52167990 (-)
LOC110535057 LOC106580217 coding downstream 64272 52089524 ~ 52131511 (-)
LOC110535922 NA coding upstream 9464 52209490 ~ 52214087 (-)
msi1b msi1 coding upstream 30485 52230511 ~ 52273985 (-)
LOC110535925 cssa20h12orf43 coding upstream 88019 52288045 ~ 52290007 (-)
LOC118936292 unc119b coding upstream 90067 52290093 ~ 52297248 (-)
mlec LOC106579938 coding upstream 98161 52298187 ~ 52305216 (-)
G991455 NA non-coding downstream 154671 52040654 ~ 52041112 (-)
G991446 NA non-coding downstream 193152 52000027 ~ 52002631 (-)
LOC110535056 LOC106579947 non-coding downstream 209929 51985306 ~ 52043206 (-)
G991421 NA non-coding downstream 224625 51965630 ~ 51971158 (-)
G991529 NA non-coding upstream 19617 52219643 ~ 52219876 (-)
G991719 NA non-coding upstream 27966 52227992 ~ 52228210 (-)
G991722 NA non-coding upstream 29583 52229609 ~ 52229881 (-)
G991729 NA non-coding upstream 45433 52245459 ~ 52246652 (-)
G991349 NA other downstream 353261 51842066 ~ 51842522 (-)
specc1la specc1l other downstream 672546 51492045 ~ 51523279 (-)
LOC118937364 LOC106585457 other downstream 829366 51364250 ~ 51370212 (-)
G990411 NA other downstream 1151475 51040780 ~ 51044308 (-)
G989880 LOC106579995 other downstream 1571678 50623430 ~ 50624105 (-)
ct030 LOC106579885 other upstream 2922484 55122507 ~ 55124484 (-)
adgra2 LOC106579839 other upstream 4490325 56690351 ~ 56787685 (-)
G997269 NA other upstream 4739012 56939038 ~ 56941535 (-)
G997343 NA other upstream 4849949 57049975 ~ 57050306 (-)
LOC110536040 LOC106579832 other upstream 4889832 57088502 ~ 57096328 (-)

Expression

LOC110535921(LOC106579942) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 300.
End of interactive chart.

LOC110535921(LOC106579942) Expression in each Bioproject

Bar chart with 21 bars.
LOC110535921(LOC106579942) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10000.
End of interactive chart.

Co-expression Network