G934028



Basic Information


Item Value
gene id G934028
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 1122163 ~ 1122430 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1064943
ctgcgtggtcccatggtgtttatacttgcatacaattgtttgtacagatgaacatggtccttcaggcatttggaaattgctcccaagcatgaaccagacttgtggcagtctacaatttttttcctgaggtcttggctgatttcttttgattttcccatgatatcaagcaaagaggcactgagtttgaaggtaggtcttgaaatacatccacaggtacatcttcaattgactcaaatgatgtcaattaccctatcagaagcttctaaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1064943 True 268 lncRNA 0.40 1 1122163 1122430

Neighbor


gene id symbol gene type direction distance location
LOC118937433 NA coding downstream 4082 1117395 ~ 1118081 (-)
LOC110535159 LOC106579762 coding downstream 132540 950711 ~ 989623 (-)
LOC110535157 LOC106579759 coding downstream 181656 909723 ~ 940507 (-)
bdh1 LOC106579760 coding downstream 222441 888551 ~ 899722 (-)
LOC110535149 LOC106579780 coding downstream 667590 441339 ~ 454573 (-)
ccdc58 ccd58 coding upstream 220255 1342685 ~ 1352332 (-)
LOC118937289 NA coding upstream 317889 1440319 ~ 1442799 (-)
LOC110535166 zic1 coding upstream 711275 1833705 ~ 1837149 (-)
LOC110535171 LOC106579747 coding upstream 2114737 3237167 ~ 3335580 (-)
LOC110535172 LOC106590674 coding upstream 2263161 3385591 ~ 3395298 (-)
G934027 NA non-coding downstream 131 1118834 ~ 1122032 (-)
G933978 NA non-coding downstream 69215 1052277 ~ 1052948 (-)
G933946 NA non-coding downstream 165353 956482 ~ 956810 (-)
G933944 NA non-coding downstream 169396 952487 ~ 952767 (-)
G933936 NA non-coding downstream 189914 930900 ~ 932249 (-)
G934039 NA non-coding upstream 6946 1129376 ~ 1129583 (-)
G934040 NA non-coding upstream 7721 1130151 ~ 1130419 (-)
G934042 NA non-coding upstream 8435 1130865 ~ 1131198 (-)
G934050 NA non-coding upstream 24853 1147283 ~ 1148900 (-)
G934053 NA non-coding upstream 27261 1149691 ~ 1149922 (-)
G933971 NA other downstream 61822 1044958 ~ 1060341 (-)
G933466 NA other downstream 743846 377102 ~ 378317 (-)
G934062 NA other upstream 34856 1157286 ~ 1159006 (-)
G934268 NA other upstream 441164 1563594 ~ 1582122 (-)
G935113 NA other upstream 1316824 2437224 ~ 2441193 (-)
G935247 NA other upstream 1541916 2664346 ~ 2664724 (-)
G936144 NA other upstream 2418998 3541428 ~ 3543319 (-)

Expression


G934028 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G934028 Expression in each Bioproject

Bar chart with 18 bars.
G934028 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network