G934254



Basic Information


Item Value
gene id G934254
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 1486923 ~ 1489972 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1065189
ctggctactgtagaacaggttcactcactatgtctactatagaacaggttcactcactatgtctactatagaacaggttcactcactatgtctactatagaacaggatcactcactgtctactgtagaacaggttcactcactatggtctactatagaacaggttcactcactatggtctactatagaacaggttcactcactatggtctattatagaacaggatcactcaccatgtctactatagaacaggttcactcactatgtctactatagaacaggatcactcactgtctactatagaacaggttcactcactgtctactatagaacaggttcactcactatggtctactatagaacaggttcactcactgtctactgtagaacaggttcactcactatggtctactgtaaaacaggttcactcactgtctactatagaacaggttcactcactatggtctactgtagaacaggttcactcactgtctactgtaaaacaggttcactcactgtctactatagaacaggttc

Function


NR:

description
PREDICTED: suprabasin

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1065189 True 536 lncRNA 0.41 3 1486923 1489972

Neighbor


gene id symbol gene type direction distance location
nktr nktr coding upstream 7295 1389373 ~ 1479628 (+)
fam162a e2ig5 coding upstream 122651 1352989 ~ 1364272 (+)
LOC110535150 LOC106590688 coding upstream 627392 742492 ~ 859531 (+)
LOC110535151 LOC106579763 coding upstream 839962 632123 ~ 646961 (+)
LOC110536523 LOC106563098 coding upstream 882584 575640 ~ 604339 (+)
LOC110535167 LOC106579754 coding downstream 353192 1839051 ~ 1855581 (+)
si:ch73-206p6.1 LOC106579752 coding downstream 886729 2376701 ~ 2387592 (+)
plod2 LOC106579751 coding downstream 929367 2419339 ~ 2530974 (+)
LOC118937290 NA coding downstream 1757854 3247826 ~ 3249391 (+)
LOC118937434 NA coding downstream 1912080 3402052 ~ 3402867 (+)
G934219 NA non-coding upstream 119622 1363369 ~ 1367301 (+)
G934193 NA non-coding upstream 160295 1320225 ~ 1326628 (+)
G934194 NA non-coding upstream 162331 1317633 ~ 1324592 (+)
G934166 NA non-coding upstream 186826 1299741 ~ 1300097 (+)
G934052 NA non-coding upstream 337020 1149635 ~ 1149903 (+)
G934256 NA non-coding downstream 1122 1488076 ~ 1496014 (+)
G934395 NA non-coding downstream 116156 1606128 ~ 1606418 (+)
G934396 NA non-coding downstream 117145 1607117 ~ 1607345 (+)
G934417 NA non-coding downstream 132210 1622182 ~ 1622412 (+)
G934440 NA non-coding downstream 149617 1639589 ~ 1639822 (+)
G934169 NA other upstream 179164 1307527 ~ 1307759 (+)
G933799 NA other upstream 535339 949531 ~ 951584 (+)
G933679 NA other upstream 758718 725187 ~ 728205 (+)
G933532 LOC106594516 other upstream 924264 539980 ~ 562659 (+)
G934579 NA other downstream 336655 1826627 ~ 1827366 (+)
G934640 NA other downstream 418688 1908660 ~ 1909080 (+)
G935846 NA other downstream 2060067 3550039 ~ 3550487 (+)
G935976 NA other downstream 2490799 3980771 ~ 3981151 (+)
G935977 NA other downstream 2491879 3981851 ~ 3982198 (+)

Expression


G934254 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G934254 Expression in each Bioproject

Bar chart with 15 bars.
G934254 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network