G936333



Basic Information


Item Value
gene id G936333
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 3992681 ~ 3993451 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1067805
AATCATTATCTCAGAGTATAACAGAACGTTAAATCATTACCTCAGGGTATAACAGAACGTTAAATCATTATCTCAGGGTGTAACAGGACATTAAATCATTATCTCAGAGTATAACAGAACGTTAAATCATTACCTTAGGGTATAACAGAACGTTAAATCATTATCTCAGGGTGTAACAGGACATTAAATCATTATCTCAGAGTATAACAGAACGTTAAATCATTACCTCAGGGTATAACAGAACGTTAAATCATTATCTCAGGGTGTAACAGAACATTACATCATTATCTCAGGGTATAACAGAACATTAAATCATTATCTCAGGGTATAACAGAACATTAAATCATTATCTCAGGGTATAACAGAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1067805 True 368 lncRNA 0.32 2 3992681 3993451

Neighbor


gene id symbol gene type direction distance location
gdap1 gdap1 coding downstream 470478 3503419 ~ 3522203 (-)
LOC110535172 LOC106590674 coding downstream 597383 3385591 ~ 3395298 (-)
LOC110535171 LOC106579747 coding downstream 657101 3237167 ~ 3335580 (-)
LOC110535166 zic1 coding downstream 2155532 1833705 ~ 1837149 (-)
LOC118937289 NA coding downstream 2549891 1440319 ~ 1442799 (-)
LOC110536524 rdh10 coding upstream 3992 3994738 ~ 4015695 (-)
terf1 terf1 coding upstream 41296 4034747 ~ 4046502 (-)
LOC110535180 LOC106909841 coding upstream 85360 4078811 ~ 4087304 (-)
LOC110536526 kcnb2 coding upstream 368283 4361734 ~ 4376996 (-)
LOC110498599 xkr9 coding upstream 1150780 5144231 ~ 5161121 (-)
G936332 NA non-coding downstream 2040 3990433 ~ 3990641 (-)
G936331 NA non-coding downstream 2710 3989702 ~ 3989971 (-)
G936330 NA non-coding downstream 6525 3985942 ~ 3986156 (-)
G936328 NA non-coding downstream 8973 3983373 ~ 3983708 (-)
G936316 NA non-coding downstream 47397 3944649 ~ 3945284 (-)
G936349 rpl7 non-coding upstream 25266 4018717 ~ 4024422 (-)
G936486 NA non-coding upstream 72109 4065516 ~ 4068749 (-)
G936506 NA non-coding upstream 107682 4101133 ~ 4103443 (-)
G936514 NA non-coding upstream 131094 4124545 ~ 4125191 (-)
G936523 NA non-coding upstream 179378 4172829 ~ 4175624 (-)
G936199 stau2 other downstream 211014 3687773 ~ 3781667 (-)
G936144 NA other downstream 449362 3541428 ~ 3543319 (-)
G935247 NA other downstream 1327957 2664346 ~ 2664724 (-)
G935113 NA other downstream 1551488 2437224 ~ 2441193 (-)
G934268 NA other downstream 2424631 1563594 ~ 1582122 (-)
G937256 NA other upstream 1048376 5041827 ~ 5042699 (-)
LOC110536541 LOC106590236 other upstream 1805858 5745494 ~ 5912106 (-)
G938130 NA other upstream 2105939 6099390 ~ 6100232 (-)

Expression


G936333 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G936333 Expression in each Bioproject

Bar chart with 10 bars.
G936333 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network