G936816



Basic Information


Item Value
gene id G936816
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 4706357 ~ 4706606 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1068438
gtatgtatgtatgtatgtatgtgtgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtgtgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtgtgtatgtatctatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtgtgtgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1068438 True 250 lncRNA 0.27 1 4706357 4706606
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118937435 msc coding upstream 119775 4583616 ~ 4586582 (+)
LOC110536527 trpa1 coding upstream 137766 4491768 ~ 4568591 (+)
LOC118937460 NA coding upstream 588954 4109412 ~ 4117403 (+)
LOC118937480 NA coding upstream 682665 4023597 ~ 4023692 (+)
LOC118937479 NA coding upstream 685025 4021240 ~ 4021332 (+)
eya1 LOC106590661 coding downstream 113139 4819745 ~ 4956185 (+)
LOC118937293 NA coding downstream 252438 4959044 ~ 4963664 (+)
LOC100136147 tram1 coding downstream 462281 5168887 ~ 5184807 (+)
LOC110536532 LOC106579720 coding downstream 486575 5193181 ~ 5518848 (+)
LOC110535182 prdm14 coding downstream 725720 5432326 ~ 5439359 (+)
G936812 NA non-coding upstream 4012 4701489 ~ 4702345 (+)
G936805 NA non-coding upstream 9769 4695496 ~ 4696588 (+)
G936795 NA non-coding upstream 40580 4664634 ~ 4665777 (+)
G936787 NA non-coding upstream 55975 4650168 ~ 4650382 (+)
G936786 NA non-coding upstream 57308 4648843 ~ 4649049 (+)
G936821 NA non-coding downstream 3221 4709827 ~ 4710063 (+)
G936839 NA non-coding downstream 26989 4733595 ~ 4734231 (+)
G936841 NA non-coding downstream 28612 4735218 ~ 4735428 (+)
G936851 NA non-coding downstream 46328 4752934 ~ 4753152 (+)
G936853 NA non-coding downstream 49269 4755875 ~ 4756308 (+)
G935977 NA other upstream 724159 3981851 ~ 3982198 (+)
G935976 NA other upstream 725206 3980771 ~ 3981151 (+)
G935846 NA other upstream 1155870 3550039 ~ 3550487 (+)
G934640 NA other upstream 2797277 1908660 ~ 1909080 (+)
G934579 NA other upstream 2878991 1826627 ~ 1827366 (+)
G937051 NA other downstream 313299 5019905 ~ 5028145 (+)
G937096 xkr9 other downstream 436711 5143317 ~ 5144565 (+)
G937237 NA other downstream 798098 5504704 ~ 5505329 (+)
G937889 NA other downstream 1414978 6121584 ~ 6122269 (+)
G938723 NA other downstream 2312545 7019151 ~ 7021424 (+)

Expression


G936816 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G936816 Expression in each Bioproject

Bar chart with 16 bars.
G936816 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network