G940233



Basic Information


Item Value
gene id G940233
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 8410118 ~ 8410328 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1072345
CAGGTTTAACCCAATAACGACACCACCATAAAACCACCTGGTGGCAGGTTTAACCCAATAACGACACCCCCATAAAACCACCTGGTGGCAGGTTTAACCCAATAACGACACCACCATAAAACCACCTGGTGGCAGGTTTAACCCAATAACGACACCCCCATAAAACCACCTGGTGGCAGGTTGGACCCAATAACGACACCACCATAAAACC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1072345 True 211 lncRNA 0.49 1 8410118 8410328
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118937462 NA coding upstream 72478 8294346 ~ 8337640 (+)
LOC110535212 LOC106579665 coding upstream 184080 8195607 ~ 8379328 (+)
LOC118937436 NA coding upstream 234333 8174793 ~ 8175785 (+)
LOC110536601 NA coding upstream 236093 8171872 ~ 8174025 (+)
LOC110535207 LOC106579684 coding upstream 438307 7969927 ~ 7971811 (+)
LOC110535213 LOC106579667 coding downstream 240110 8650438 ~ 8685656 (+)
LOC110535219 NA coding downstream 389212 8799540 ~ 8802257 (+)
LOC118937463 NA coding downstream 435237 8845565 ~ 8855476 (+)
LOC110535221 LOC106579618 coding downstream 446778 8857106 ~ 8860218 (+)
LOC100135908 LOC100135908 coding downstream 459248 8869576 ~ 8880714 (+)
G940110 NA non-coding upstream 8512 8401369 ~ 8401606 (+)
G940108 NA non-coding upstream 12315 8397572 ~ 8397803 (+)
G940105 NA non-coding upstream 21876 8388020 ~ 8388242 (+)
G940087 NA non-coding upstream 58779 8350382 ~ 8351339 (+)
G939970 NA non-coding upstream 254502 8155402 ~ 8155616 (+)
G940234 NA non-coding downstream 104 8410432 ~ 8410666 (+)
G940239 NA non-coding downstream 14172 8424500 ~ 8424736 (+)
G940249 NA non-coding downstream 30692 8441020 ~ 8441243 (+)
G940258 NA non-coding downstream 37721 8448049 ~ 8448255 (+)
G940260 NA non-coding downstream 39733 8450061 ~ 8450458 (+)
LOC110536544 LOC106590277 other upstream 28538 8379847 ~ 8497020 (+)
G940102 NA other upstream 32190 8374506 ~ 8377928 (+)
G939690 NA other upstream 269535 8140266 ~ 8140583 (+)
G939544 NA other upstream 586801 7820520 ~ 7823317 (+)
G940247 NA other downstream 29152 8439480 ~ 8439775 (+)
G940313 NA other downstream 122212 8532540 ~ 8540867 (+)
G940376 NA other downstream 241176 8651504 ~ 8652993 (+)
G941893 NA other downstream 1834781 10245109 ~ 10245506 (+)

Expression


G940233 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G940233 Expression in each Bioproject

Bar chart with 11 bars.
G940233 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network