G943710



Basic Information


Item Value
gene id G943710
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 11979181 ~ 11979592 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1076228
GAGATGAGCAATTCATGGATTTGATGGCATTATAACACCATAAGAAGAGATATGAGTATTCTAAAAAGAAACTGAAAATTCTGGTAAGGAAAAGAAAGGGTGGCAACAGAGGTAGAGTGTGACAGATGAGAAGGTTCGAAGACATCAGGAGTGAGGGAGTTGATGAGTTAGAAAAGAGAGCGGAGAGATGACTCTTACCCGCATGCCTTCAAATCGGGACAGTGCTCTTAGCGGCCTCAGAGCTCTGAGGGTTCTAAGTGATTTGATGGCAGCGAAGTCCGAGTAGCCAAGCGTGTTAGCCACTAGGCTCACCAAAGACACCTAGGAGGATGAAGAAAGGGCAAGTACCCACATGGTTAGGGGGGCTGCCACAACCTGTTCAAAGAAATGTCAACACAGTACCTGAAAAGGA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1076228 True 412 lncRNA 0.46 1 11979181 11979592
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110535274 LOC100136506 coding upstream 93415 11798079 ~ 11885766 (+)
LOC110535272 LOC106579661 coding upstream 430941 11545457 ~ 11548240 (+)
LOC110535269 LOC106579659 coding upstream 437683 11499972 ~ 11541498 (+)
LOC110535264 LOC106579657 coding upstream 481343 11178332 ~ 11497838 (+)
LOC110535275 NA coding downstream 100671 12080263 ~ 12080894 (+)
LOC110535276 LOC106579583 coding downstream 197321 12176913 ~ 12191408 (+)
LOC110535277 LOC106579584 coding downstream 213813 12193405 ~ 12246357 (+)
LOC110535283 LOC106579606 coding downstream 285473 12265065 ~ 12274786 (+)
LOC110535281 riok3 coding downstream 295690 12275282 ~ 12283258 (+)
G943662 NA non-coding upstream 60158 11918631 ~ 11919023 (+)
G943661 NA non-coding upstream 61992 11916980 ~ 11917189 (+)
G943653 NA non-coding upstream 70460 11907416 ~ 11908721 (+)
G943615 NA non-coding upstream 88007 11889563 ~ 11891174 (+)
G943616 NA non-coding upstream 89709 11887634 ~ 11889472 (+)
G943713 LOC106590371 non-coding downstream 2265 11981857 ~ 11991290 (+)
G943748 NA non-coding downstream 74310 12053902 ~ 12054193 (+)
G943749 NA non-coding downstream 74943 12054535 ~ 12054922 (+)
G943750 NA non-coding downstream 75548 12055140 ~ 12055517 (+)
G943785 NA non-coding downstream 135235 12114827 ~ 12115161 (+)
G942702 NA other upstream 867845 11110726 ~ 11111336 (+)
G941893 NA other upstream 1733675 10245109 ~ 10245506 (+)
LOC118937463 NA other upstream 3123744 8845565 ~ 8855476 (+)
G940376 NA other upstream 3326660 8651504 ~ 8652993 (+)
G940313 NA other upstream 3438314 8532540 ~ 8540867 (+)
G944957 NA other downstream 1407958 13387550 ~ 13394875 (+)
G946426 ramp3 other downstream 2084956 14064548 ~ 14065869 (+)
LOC110535304 NA other downstream 2175762 14154784 ~ 14202999 (+)
G946644 NA other downstream 2330983 14310575 ~ 14314318 (+)
G946643 NA other downstream 2338416 14318008 ~ 14318623 (+)

Expression


G943710 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.75.
End of interactive chart.

G943710 Expression in each Bioproject

Bar chart with 4 bars.
G943710 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network