G943750



Basic Information


Item Value
gene id G943750
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 12055140 ~ 12055517 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1076272
cggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacgggcctctgagactatcacagtgcaggtgcatttatatggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgccaaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttcccttcatgattgtgtcccacttgttgttgattcttcacaaaaaaatacagttttatatc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1076272 True 378 lncRNA 0.38 1 12055140 12055517
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110535274 LOC100136506 coding upstream 169374 11798079 ~ 11885766 (+)
LOC110535272 LOC106579661 coding upstream 506900 11545457 ~ 11548240 (+)
LOC110535269 LOC106579659 coding upstream 513642 11499972 ~ 11541498 (+)
LOC110535264 LOC106579657 coding upstream 557302 11178332 ~ 11497838 (+)
LOC110535275 NA coding downstream 24746 12080263 ~ 12080894 (+)
LOC110535276 LOC106579583 coding downstream 121396 12176913 ~ 12191408 (+)
LOC110535277 LOC106579584 coding downstream 137888 12193405 ~ 12246357 (+)
LOC110535283 LOC106579606 coding downstream 209548 12265065 ~ 12274786 (+)
LOC110535281 riok3 coding downstream 219765 12275282 ~ 12283258 (+)
G943749 NA non-coding upstream 218 12054535 ~ 12054922 (+)
G943748 NA non-coding upstream 947 12053902 ~ 12054193 (+)
G943713 LOC106590371 non-coding upstream 63850 11981857 ~ 11991290 (+)
G943710 NA non-coding upstream 75548 11979181 ~ 11979592 (+)
G943662 NA non-coding upstream 136117 11918631 ~ 11919023 (+)
G943785 NA non-coding downstream 59310 12114827 ~ 12115161 (+)
G943787 NA non-coding downstream 61562 12117079 ~ 12122615 (+)
G943817 NA non-coding downstream 108751 12164268 ~ 12164536 (+)
G943820 LOC106583515 non-coding downstream 113482 12168999 ~ 12169446 (+)
G943827 LOC106579585 non-coding downstream 196463 12251980 ~ 12252197 (+)
G942702 NA other upstream 943804 11110726 ~ 11111336 (+)
G941893 NA other upstream 1809634 10245109 ~ 10245506 (+)
LOC118937463 NA other upstream 3199703 8845565 ~ 8855476 (+)
G940376 NA other upstream 3402619 8651504 ~ 8652993 (+)
G940313 NA other upstream 3514273 8532540 ~ 8540867 (+)
G944957 NA other downstream 1332033 13387550 ~ 13394875 (+)
G946426 ramp3 other downstream 2009031 14064548 ~ 14065869 (+)
LOC110535304 NA other downstream 2099837 14154784 ~ 14202999 (+)
G946644 NA other downstream 2255058 14310575 ~ 14314318 (+)
G946643 NA other downstream 2262491 14318008 ~ 14318623 (+)

Expression


G943750 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G943750 Expression in each Bioproject

Bar chart with 20 bars.
G943750 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network